Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU130851

Sigma-Aldrich

MISSION® esiRNA

targeting human EGF

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTTGCTGTGGACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGAAGGAGTGATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCACGAGGAATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAATCCACGAATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGATCTAATCTGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGATGCCAAGCAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACCCAGAATGATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCAGATTGGGCTATGCCAT

Ensembl | Número de adesão de ser humano

ENSG00000138798

nº de adesão NCBI

NM_001963

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... EGF(1950) , EGF(1950)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mingli Duan et al.
Molecular medicine reports, 18(2), 1651-1659 (2018-05-31)
Migration and invasion are the most important characteristics of human malignancies which limit cancer drug therapies in the clinic. Tongue squamous cell carcinoma (TSCC) is one of the rarest types of cancer, although it is characterized by a higher incidence
Pengfei Liu et al.
Life sciences, 230, 45-54 (2019-05-28)
The action of cell-based therapy against acute kidney injury (AKI) has been demonstrated by different groups for years. However, which kind of cells hold best therapeutic effect remains unclear. In this study, we mainly explored whether human placental trophoblast cells
Ding Zhang et al.
Clinical and translational medicine, 10(8), e231-e231 (2020-12-31)
Acute lung injury is a serious form and major cause of patient death and still needs efficient therapies. The present study evidenced that co-transplantation of mesenchymal stem cells (MSCs) and telocytes (TCs) improved the severity of experimental lung tissue inflammation
Ying-Hsia Shih et al.
Oncotarget, 6(18), 16601-16610 (2015-06-13)
Colorectal adenocarcinoma is a common cause death cancer in the whole world. The aim of this study is to define the 111In-cetuximab as a diagnosis tracer of human colorectal adenocarcinoma. In this research, cell uptake, nano-SPECT/CT scintigraphy, autoradiography, biodistribution and
Dongqing Li et al.
The Journal of clinical investigation, 125(8), 3008-3026 (2015-06-30)
Wound healing is a complex process that is characterized by an initial inflammatory phase followed by a proliferative phase. This transition is a critical regulatory point; however, the factors that mediate this process are not fully understood. Here, we evaluated

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica