Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU129261

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK6, BUB1B-PAK6

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGCTGGACAGCTACGTGAAGATTGGCGAGGGCTCCACCGGCATCGTCTGCTTGGCCCGGGAGAAGCACTCGGGCCGCCAGGTGGCCGTCAAGATGATGGACCTCAGGAAGCAGCAGCGCAGGGAGCTGCTCTTCAACGAGGTGGTGATCATGCGGGACTACCAGCACTTCAACGTGGTGGAGATGTACAAGAGCTACCTGGTGGGCGAGGAGCTGTGGGTGCTCATGGAGTTCCTGCAGGGAGGAGCCCTCACAGACATCGTCTCCCAAGTCAGGCTGAATGAGGAGCAGATTGCCACTGTGTGTGAGGCTGTGCTGCAGGCCCTGGCCTACCTGCATGCTCAGGGTGTCATCCACCGGGACATCAAGAGTGACTCCATCCTGCTGACCCTCGATGGCAGGGTGAAGCTCTCGGACTTCGGATTCTGTGCTCAGATCAGCAAAGACGTCCCTAAGAGGAAGTCCCTGGTGGGAACCCCCTACTGGATGGCTCCTGAAGTGATCTCCAGGTCTTTGTATGCCACTGAGGTGGATATCTGGTCTCTGGGCATCATGGTGATTGAGATGGTAGATGGGGAGC

Ensembl | Número de adesão de ser humano

ENSG00000137843

nº de adesão NCBI

NM_001128628

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PAK6(106821730) , PAK6(56924)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
JUU
NRR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Daniel Pensold et al.
Cerebral cortex (New York, N.Y. : 1991), 27(12), 5696-5714 (2017-11-09)
The proliferative niches in the subpallium generate a rich cellular variety fated for diverse telencephalic regions. The embryonic preoptic area (POA) represents one of these domains giving rise to the pool of cortical GABAergic interneurons and glial cells, in addition
Sally Fram et al.
Cellular and molecular life sciences : CMLS, 71(14), 2759-2773 (2013-12-20)
p-21 activated 6 (PAK6), first identified as interacting with the androgen receptor (AR), is over-expressed in multiple cancer tissues and has been linked to the progression of prostate cancer, however little is known about PAK6 function in the absence of
Jian Zhai et al.
Biochemical and biophysical research communications, 464(1), 161-167 (2015-06-28)
Emerging evidence suggests that microRNAs (miRNAs) play important roles in regulating HCC development and progression; however, the mechanisms by which their specific functions and mechanisms remained to be further explored. miR-129 has been reported in gastric cancers, lung cancer and
Songwang Cai et al.
Oncotarget, 6(6), 3904-3917 (2015-02-26)
Here we found that levels of miR-23a were decreased in prostate cancer cell lines and tumor tissues. These low levels were associated with poor patients' prognosis. MiR-23a inhibited migration and invasion of prostate cancer in vivo and in orthotopic prostate
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica