Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU123781

Sigma-Aldrich

MISSION® esiRNA

targeting human CYB5R3

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTACCTCTCGGCTCGAATTGATGGAAACCTGGTCGTCCGGCCCTATACACCCATCTCCAGCGATGATGACAAGGGCTTCGTGGACCTGGTCATCAAGGTTTACTTCAAGGACACCCATCCCAAGTTTCCCGCTGGAGGGAAGATGTCTCAGTACCTGGAGAGCATGCAGATTGGAGACACCATTGAGTTCCGGGGCCCCAGTGGGCTGCTGGTCTACCAGGGCAAAGGGAAGTTCGCCATCCGACCTGACAAAAAGTCCAACCCTATCATCAGGACAGTGAAGTCTGTGGGCATGATCGCGGGAGGGACAGGCATCACCCCGATGCTGCAGGTGATCCGCGCCATCATGAAGGACCCTGATGACCACACTGTGTGCCACCTGCTCTTTGCCAACCAGACCGAGAAGGACATCCTGCTGCGACCTGAGCTGGAGGAACTCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Birte Plitzko et al.
Drug metabolism and disposition: the biological fate of chemicals, 44(10), 1617-1621 (2016-07-30)
The importance of the mitochondrial amidoxime reducing component (mARC)-containing enzyme system in N-reductive metabolism has been studied extensively. It catalyzes the reduction of various N-hydroxylated compounds and therefore acts as the counterpart of cytochrome P450- and flavin-containing monooxygenase-catalyzed oxidations at
Manoj Reddy Medapati et al.
Thyroid : official journal of the American Thyroid Association, 25(5), 514-527 (2015-03-07)
Expression of the small calcium-binding protein S100A4 is associated with poor prognosis in patients with thyroid cancer (TC). The authors have previously shown that S100A4 is a target for relaxin and insulin-like peptide 3 signaling in TC cells and that

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica