Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU119551

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAGCTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTCAGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTCACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGCAGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTGCTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCTACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCCCCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGGCCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGT

Ensembl | Número de adesão de ser humano

ENSG00000184557

nº de adesão NCBI

NM_003955

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SOCS3(9021) , SOCS3(9021)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IAV
DAV
EZU
KXU
OWU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ranu Surolia et al.
American journal of physiology. Lung cellular and molecular physiology, 311(5), L928-L940 (2016-11-04)
Pulmonary infections with nontuberculous mycobacteria (P-NTM), such as by Mycobacterium avium complex (M. avium), are increasingly found in the elderly, but the underlying mechanisms are unclear. Recent studies suggest that adaptive immunity is necessary, but not sufficient, for host defense
Naotoshi Iwahara et al.
Journal of Alzheimer's disease : JAD, 55(3), 1235-1247 (2016-11-05)
In response to changes of the central nervous system environment, microglia are capable of acquiring diverse phenotypes for cytotoxic or immune regulation and resolution of injury. Alzheimer's disease (AD) pathology also induces several microglial activations, resulting in production of pro-inflammatory
Mandy Boontanrart et al.
Journal of neuroimmunology, 292, 126-136 (2016-03-06)
Microglia become activated immune cells during infection or disease in the central nervous system (CNS). However, the mechanisms that downregulate activated microglia to prevent immune-mediated damage are not completely understood. Vitamin D3 has been suggested to have immunomodulatory affects, and
Rak-Kyun Seong et al.
Pathogens (Basel, Switzerland), 9(3) (2020-03-04)
Zika virus (ZIKV) is a mosquito-borne flavivirus that has emerged and caused global outbreaks since 2007. Although ZIKV proteins have been shown to suppress early anti-viral innate immune responses, little is known about the exact mechanisms. This study demonstrates that
Yan Zhang et al.
Journal of neuroinflammation, 14(1), 211-211 (2017-11-04)
Morphine tolerance is a clinical challenge, and its pathogenesis is closely related to the neuroinflammation mediated by Toll-like receptor 4 (TLR4). In Chinese pain clinic, lidocaine is combined with morphine to treat chronic pain. We found that lidocaine sufficiently inhibited
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica