Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU115751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGACCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCGCCCGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTGGCCATTAAGGAGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAGGAGGTGGACATCTATACCGTCAAGGTGGAAGACCTGACC

Ensembl | Número de adesão de ser humano

ENSG00000126457

nº de adesão NCBI

NM_198319

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PRMT1(3276) , PRMT1(3276)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
PZT
KYT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Eun-Kyung Moon et al.
The Korean journal of parasitology, 55(2), 109-114 (2017-05-17)
Protein arginine methyltransferase (PRMT) is an important epigenetic regulator in eukaryotic cells. During encystation, an essential process for
Jong-Hyun Nho et al.
Biochemical and biophysical research communications, 530(2), 389-395 (2020-06-14)
Recent studies have revealed that protein arginine methyltransferases (PRMTs) are responsible for diverse neurodegenerative diseases. However, their pathophysiological role in dopaminergic neuronal death in Parkinson's disease (PD) has not been evaluated. In this study, we demonstrated that 1-Methyl-4-phenylpyridinium iodide (MPP+)
H Wei et al.
Neoplasma, 66(6), 918-929 (2019-10-15)
Protein arginine methyltransferase 1 (PRMT1) is dysregulated in a number of human cancers. Herein, we report that PRMT1 expression is directly associated with epithelial-mesenchymal transition (EMT) in hepatic carcinoma cells. Firstly, we find that PRMT1 expression is higher in hepatic
Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Weiqi Zhai et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 11-22 (2020-11-27)
Protein arginine methyltransferase-1 (PRMT1) is an important epigenetic regulator of cell function and contributes to inflammation and remodeling in asthma in a cell type-specific manner. Disease-specific expression patterns of microRNAs (miRNA) are associated with chronic inflammatory lung diseases, including asthma.
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica