Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU078751

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGATGATTGACTCTGAATGTCGGCCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGCTTTGTGGTCATCCAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGGACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGTCCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGACCTGACACTAGGGCTGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAAGGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAAT

Ensembl | Número de adesão de ser humano

ENSG00000141736

nº de adesão NCBI

NM_004448

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ERBB2(2064) , ERBB2(2064)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ACNV
JUU
OZT
IYT
BJS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tong Shu et al.
Cancer letters, 411, 65-73 (2017-10-11)
Resistance to platinum-based chemotherapy is a major cause of treatment failure in patients with epithelial ovarian cancer and predicts a poor prognosis. Previously, we found that HECTD3 confers cancer cell resistance to apoptosis. However, the significance of HECTD3 expression in
Yiseul Choi et al.
World journal of gastroenterology, 22(41), 9141-9153 (2016-11-30)
To investigated the relationships between HER2, c-Jun N-terminal kinase (JNK) and protein kinase B (AKT) with respect to metastatic potential of HER2-positive gastric cancer (GC) cells. Immunohistochemistry was performed on tissue array slides containing 423 human GC specimens. Using HER2-positve
Zhipeng Li et al.
British journal of cancer, 120(3), 306-316 (2018-12-27)
Epidermal growth factor receptor (EGFR) plays an important role in head and neck squamous cell carcinoma (HNSCC) proliferation and therapy resistance, but the efficacy of targeting of EGFR for therapy has been limited. Here, we explore the molecular link between
Nehal Gupta et al.
Scientific reports, 9(1), 5066-5066 (2019-03-27)
Paclitaxel is a first line chemotherapeutic agent for the patients with metastatic breast cancer. But inherited or acquired resistance to paclitaxel leads to poor response rates in a majority of these patients. To identify mechanisms of paclitaxel resistance, we developed
Tiia Honkanen et al.
International journal of oncology, 51(2), 599-606 (2017-06-29)
We have previously shown that cancer stem-like cells (CSLCs) can mediate therapy resistance in ALK translocated lung cancers. HER2 has been linked to CSLCs in breast cancers and, therefore, we wanted to assess whether HER2 has a role in CSLCs
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica