Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU066851

Sigma-Aldrich

MISSION® esiRNA

targeting human PYCARD

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTGGACCTCACCGACAAGCTGGTCAGCTTCTACCTGGAGACCTACGGCGCCGAGCTCACCGCTAACGTGCTGCGCGACATGGGCCTGCAGGAGATGGCCGGGCAGCTGCAGGCGGCCACGCACCAGGGCCTGCACTTTATAGACCAGCACCGGGCTGCGCTTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGACGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGCTCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAAGGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGAGGCTCCTTCCCAGCAACACTCCGGTCAGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lanny Gov et al.
mBio, 4(4) (2013-07-11)
Interleukin-1β (IL-1β) functions as a key regulator of inflammation and innate immunity. The protozoan parasite Toxoplasma gondii actively infects human blood monocytes and induces the production of IL-1β; however, the host and parasite factors that mediate IL-1β production during T.
Mairaj Ahmed Ansari et al.
PLoS pathogens, 11(7), e1005019-e1005019 (2015-07-03)
The IL-1β and type I interferon-β (IFN-β) molecules are important inflammatory cytokines elicited by the eukaryotic host as innate immune responses against invading pathogens and danger signals. Recently, a predominantly nuclear gamma-interferon-inducible protein 16 (IFI16) involved in transcriptional regulation has
Minda Zhang et al.
Journal of cellular physiology, 234(11), 20161-20173 (2019-04-07)
The human absent in melanoma 2 (AIM2) is considered as a DNA recognizer. AIM2 has been described as a tumor suppressor gene in the early years. But recent studies suggested that it functions as an oncogene in several cancers. However
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Fushan Shi et al.
Journal of neuroinflammation, 9, 73-73 (2012-04-26)
Prion diseases are neurodegenerative disorders characterized by the accumulation of an abnormal disease-associated prion protein, PrPSc. In prion-infected brains, activated microglia are often present in the vicinity of PrPSc aggregates, and microglial activation is thought to play a key role

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica