Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU057101

Sigma-Aldrich

MISSION® esiRNA

targeting human PINK1, PINK1-AS

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGGAGTGTGAAACGCTCTGCCAGGCAGCCCTCCTCCTCTGCTCATGGAGGGCAGCCCTGTGATGTCCCTGCATGGAGCTGGTGAATTACTAAAAGAACATGGCATCCTCTGTGTCGTGATGGTCTGTGAATGGTGAGGGTGGGAGTCAGGAGACAAGACAGCGCAGAGAGGGCTGGTTAGCCGGAAAAGGCCTCGGGCTTGGCAAATGGAAGAACTTGAGTGAGAGTTCAGTCTGCAGTCCTCTGCTCACAGACATCTGAAAAGTGAATGGCCAAGCTGGTCTAGTAGATGAGGCTGGACTGAGGAGGGGTAGGCCTGCATCCACAGAGAGGATCCAGGCCAAGGCACTGGCTGTCAGTGGCAGAGTTTGGCTGTGACCTTTGCCCCTAACACGAGGAACTCGTTTGAAGGGGGCAGCGTAGCATGTCTGATTTGCCACCTGGAT

Ensembl | Número de adesão de ser humano

ENSG00000158828

nº de adesão NCBI

NM_032409

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PINK1(65018) , PINK1(65018)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IZU
HXU
JUU
XMU
JIU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

C-N Yang et al.
International endodontic journal, 52(5), 676-688 (2018-12-12)
To assess the connection between mitophagy and hypoxia-induced apoptosis in osteoblasts and whether simvastatin alleviates bone resorption in apical periodontitis through modulation of mitophagy-related apoptosis. Hypoxia-induced generation of reactive oxygen species in mitochondria and changes in mitochondrial membrane potential were
Yuan Xu et al.
Molecular neurobiology, 56(1), 252-266 (2018-04-25)
There is emerging evidence suggesting that neurotoxic insults and hypoxic/ischemic injury are underlying causes of Parkinson's disease (PD). Since PTEN-induced kinase 1 (PINK1) dysfunction is involved in the molecular genesis of PD and since our recent studies have demonstrated that
Yan Gao et al.
Biochemical pharmacology, 177, 113997-113997 (2020-05-01)
Alzheimer's disease (AD) is an irreversible neurodegenerative brain disorder with complex pathogenesis. The fibrillar peptide β-amyloid (Aβ) has a chief function in the pathogenesis of AD. Emerging evidence has indicated that there is a tight relationship between inflammation, mitochondrial dysfunction
Limin Wei et al.
International journal of nanomedicine, 12, 1891-1903 (2017-03-24)
With the increasing application of zinc oxide nanoparticles (ZnO NPs) in biological materials, the neurotoxicity caused by these particles has raised serious concerns. However, the underlying molecular mechanisms of the toxic effect of ZnO NPs on brain cells remain unclear.
Juan Liu et al.
Nature communications, 8(1), 1823-1823 (2017-11-29)
Mutations in E3 ubiquitin ligase Parkin have been linked to familial Parkinson's disease. Accumulating evidence suggests that Parkin is a tumor suppressor, but the underlying mechanism is poorly understood. Here we show that Parkin is an E3 ubiquitin ligase for
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica