Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU053481

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK9

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TACGAGAAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAGACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCCATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAACTTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATACCTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAGTTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATCCACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGATGGGGTCCTGAAGCTGGCAGACTTT

Ensembl | Número de adesão de ser humano

ENSG00000136807

nº de adesão NCBI

NM_001261

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CDK9(1025) , CDK9(1025)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jinglu Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(5), 5990-6000 (2019-02-07)
Despite surgical and chemotherapeutic advances over the past few decades, the prognosis for ovarian cancer remains very poor. Although cyclin-dependent kinase (CDK) 9 has an established pathogenic role in various cancers, its function in ovarian cancer remains poorly defined. The
So-Young Kim et al.
PloS one, 10(12), e0146073-e0146073 (2016-01-01)
Breast cancer cells generally develop resistance to TNF-Related Apoptosis-Inducing Ligand (TRAIL) and, therefore, assistance from sensitizers is required. In our study, we have demonstrated that Spleen tyrosine kinase (Syk) inhibitor Bay 61-3606 was identified as a TRAIL sensitizer. Amplification of
Muhammed H Rahaman et al.
Molecular oncology, 13(10), 2178-2193 (2019-08-10)
Colorectal cancer (CRC) remains one of the most lethal human malignancies, and pursuit of new therapeutic targets for treatment has been a major research focus. Cyclin-dependent kinase 9 (CDK9), which plays a crucial role in transcription, has emerged as a
Nicole Pinto et al.
PloS one, 15(9), e0239315-e0239315 (2020-09-25)
Anaplastic thyroid cancer (ATC) is a rare, but nearly uniformly fatal disease that is typically resistant to chemotherapy and radiation. Alternative strategies to target this cancer at a molecular level are necessary in order to improve dismal outcomes for ATC
Hangzhan Ma et al.
EBioMedicine, 39, 182-193 (2018-12-24)
Cyclin-dependent protein kinase 9 (CDK9) has been shown to play an important role in the pathogenesis of malignant tumors. However, the expression and function of CDK9 remain unknown in osteosarcomas. The purpose of this study is to assess the expression
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica