Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU048791

Sigma-Aldrich

MISSION® esiRNA

targeting human GCLC

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAGCTTCCAAGTCCCTCTTCTTTCCAGATGAAGCAATAAACAAGCACCCTCGCTTCAGTACCTTAACAAGAAATATCCGACATAGGAGAGGAGAAAAGGTTGTCATCAATGTACCAATATTTAAGGACAAGAATACACCATCTCCATTTATAGAAACATTTACTGAGGATGATGAAGCTTCAAGGGCTTCTAAGCCGGATCATATTTACATGGATGCCATGGGATTTGGAATGGGCAATTGCTGTCTCCAGGTGACATTCCAAGCCTGCAGTATATCTGAGGCCAGATACCTTTATGATCAGTTGGCTACTATCTGTCCAATTGTTATGGCTTTGAGTGCTGCATCTCCCTTTTACCGAGGCTATGTGTCAGACATTGATTGTCGCTGGGGAGTGATTTCTGCATCTGTAGATGATAGAACTCGGGAGGAGCGAGGACTGGAGCCATTGAAGAA

Ensembl | Número de adesão de ser humano

ENSG00000001084

nº de adesão NCBI

NM_001498

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... GCLC(2729) , GCLC(2729)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Preeti Kanikarla-Marie et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(6), 2160-2170 (2015-11-26)
Type 1 diabetic (T1D) patients have a higher incidence of liver disease. T1D patients frequently experience elevated plasma ketone levels along with hyperglycemia. However, no study has examined whether hyperketonemia per se has any role in excess liver damage in
Dulani Wimalachandra et al.
Biochimica et biophysica acta, 1863(1), 71-80 (2017-10-21)
Endometriosis is a disease characterized by regurgitated lesions which are invasive and migratory, embedding at ectopic, extra-uterine locations. Extracellular glucosylceramides (GlcCers), bioactive sphingolipids potentiating signals for cell migration, are found in elevated levels in endometriosis; however underlying mechanisms that result
Arunkumar E Achari et al.
Archives of biochemistry and biophysics, 630, 54-65 (2017-08-02)
Diabetic patients have lower blood levels of l-cysteine (LC) and glutathione (GSH). This study examined the hypothesis that LC supplementation positively up regulates the effects of insulin on GSH and glucose metabolism in 3T3-L1 adipocyte model. 3T3L1 adipocytes were treated
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica