Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU042391

Sigma-Aldrich

MISSION® esiRNA

targeting human ETHE1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGTGTCACCTTCGTCCTGAATGACCACAGCATGGCCTTCACTGGAGATGCCCTGTTGATCCGTGGGTGTGGGCGGACAGACTTCCAGCAAGGCTGTGCCAAGACCTTGTACCACTCGGTCCATGAAAAGATCTTCACACTTCCAGGAGACTGTCTGATCTACCCTGCTCACGATTACCATGGGTTCACAGTGTCCACCGTGGAGGAGGAGAGGACTCTGAACCCTCGGCTCACCCTCAGCTGTGAGGAGTTTGTCAAAATCATGGGCAACCTGAACTTGCCTAAACCTCAGCAGATAGACTTTGCTGTTCCAGCCAACATGCGCTGTGGGGTGCAGACACCCACTGCCTGATCTCACTTCTGTCAGATGCTCCCATCCACTATTAATGCACTAGGTGGGAGGAGAGGGCGGCAATGACACTGCACCTCTCCTTTCCCACCGCATTCCCTGGAGCTCCCTAAA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuhui Hao et al.
Scientific reports, 6, 38942-38942 (2016-12-15)
The purpose of this study was to investigate the underlying mechanism of metallothionein (MT) protection from depleted uranium (DU) using a proteomics approach to search for a DU toxicity-differential protein. MT-/- and MT+/+ mice were administrated with a single dose
Yuhui Hao et al.
Journal of biochemical and molecular toxicology, 35(3), e22669-e22669 (2020-12-05)
The kidney is the target of the acute toxicity of depleted uranium (DU). However, the mechanism of DU-induced cytotoxicity is not clear. The study was to demonstrate the role of autophagy in DU-induced cytotoxicity and to determine the potential mechanism.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica