Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU035111

Sigma-Aldrich

MISSION® esiRNA

targeting human PHGDH

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCATCAACGCAGCTGAGAAACTCCAGGTGGTGGGCAGGGCTGGCACAGGTGTGGACAATGTGGATCTGGAGGCCGCAACAAGGAAGGGCATCTTGGTTATGAACACCCCCAATGGGAACAGCCTCAGTGCCGCAGAACTCACTTGTGGAATGATCATGTGCCTGGCCAGGCAGATTCCCCAGGCGACGGCTTCGATGAAGGACGGCAAATGGGAGCGGAAGAAGTTCATGGGAACAGAGCTGAATGGAAAGACCCTGGGAATTCTTGGCCTGGGCAGGATTGGGAGAGAGGTAGCTACCCGGATGCAGTCCTTTGGGATGAAGACTATAGGGTATGACCCCATCATTTCCCCAGAGGTCTCGGCCTCCTTTGGTGTTCAGCAGCTGCCCCTGGAGGAGATCTGGCCTCTCTGTGATTTCATCACTGTGCACACTCCTCTCCTGCCCTCCACGACAGGCTTGCTGAATGACA

Ensembl | Número de adesão de ser humano

ENSG00000092621

nº de adesão NCBI

NM_006623

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PHGDH(26227) , PHGDH(26227)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wen-Bin Guo et al.
Reproductive biology and endocrinology : RB&E, 18(1), 70-70 (2020-07-16)
Although varicocele is considered to be one of the leading causes of male infertility, the precise mechanism underlying how varicocele leads to male infertility is not completely understood. We found the lactate concentration on the varicocele side of the patients
Mai Q Nguyen et al.
The Journal of investigative dermatology, 140(11), 2242-2252 (2020-05-12)
Melanomas frequently harbor activating NRAS mutations leading to activation of MAPK kinase (MEK) and extracellular signal-regulated kinase 1/2 signaling; however, the clinical efficacy of inhibitors to this pathway is limited by resistance. Tumors rewire metabolic pathways in response to stress
Florence Polet et al.
Oncotarget, 7(2), 1765-1776 (2015-12-02)
Leukemia cells are described as a prototype of glucose-consuming cells with a high turnover rate. The role of glutamine in fueling the tricarboxylic acid cycle of leukemia cells was however recently identified confirming its status of major anaplerotic precursor in
Samah Elsaadi et al.
Experimental hematology & oncology, 10(1), 3-3 (2021-01-06)
Multiple myeloma (MM) is a hematological malignancy characterized by the clonal expansion of plasma cells in the bone marrow. To date, this disease is still incurable and novel therapeutic approaches are required. Phosphoglycerate dehydrogenase (PHGDH) is the first and rate-limiting
Amit Subedi et al.
FEBS letters, 593(8), 763-776 (2019-03-16)
Differences in the metabolism of cancer cells or cancer stem cells (CSCs) as compared to normal cells have provided avenues to safely target cancers. To discover metabolic inhibitors of CSCs, we performed alkaline phosphatase- and tumoursphere-based drug screening using induced
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica