Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU033441

Sigma-Aldrich

MISSION® esiRNA

targeting human XPC

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGTTTCAATAAAGGGGTCCATGAGGACACACACAAGGTTCACCTTCTCTGCCTGCTAGCAAATGGCTTCTATCGAAATAACATCTGCAGCCAGCCAGATCTGCATGCTATTGGCCTGTCCATCATCCCAGCCCGCTTTACCAGAGTGCTGCCTCGAGATGTGGACACCTACTACCTCTCAAACCTGGTGAAGTGGTTCATTGGAACATTTACAGTTAATGCAGAACTTTCAGCCAGTGAACAAGATAACCTGCAGACTACATTGGAAAGGAGATTTGCTATTTACTCTGCTCGAGATGATGAGGAATTGGTCCATATATTCTTACTGATTCTCCGGGCTCTGCAGCTCTTGACCCGGCTGGTATTGTCTCTACAGCCAATTCCTCTGAAGTCAGCAACAGCAAAGGGAAAGA

Ensembl | Número de adesão de ser humano

ENSG00000154767

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... XPC(7508) , XPC(7508)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Timothy Budden et al.
BMC cancer, 18(1), 100-100 (2018-01-28)
Melanoma has two key features, an over-representation of UV-induced mutations and resistance to DNA damaging chemotherapy agents. Both of these features may result from dysfunction of the nucleotide excision repair pathway, in particular the DNA damage detection branch, global genome
Jyh-Cheng Chen et al.
Pharmacology, 102(1-2), 91-104 (2018-06-29)
Etoposide (VP16) is a topoisomerase II inhibitor and has been used for the treatment of non-small cell lung cancer (NSCLC). Xeroderma pigmentosum complementation group C (XPC) protein is a DNA damage recognition factor in nucleotide excision repair and involved in
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine
Jyh-Cheng Chen et al.
Toxicology research, 7(6), 1247-1256 (2018-12-18)
Astaxanthin has been demonstrated to exhibit a wide range of beneficial effects that include anti-cancer and anti-inflammatory properties. Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair and is involved in
Tiantian Cui et al.
Oncotarget, 6(12), 10060-10072 (2015-04-15)
Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair. Deletion of XPC is associated with early stages of human lung carcinogenesis, and reduced XPC mRNA levels predict poor patient outcome for

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica