Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU030431

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTCCGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCTGGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCCAGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGCCCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTCCTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAGCTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCAAATACTGCAACAAGGAATACCTCAGCCTGG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hong Li et al.
Theranostics, 9(7), 1909-1922 (2019-05-01)
Rationale: Glioblastoma (GBM) is the most common and aggressive brain tumor, characterized by its propensity to invade the surrounding brain parenchyma. The effect of extracellular high-mobility group box 1 (HMGB1) protein on glioblastoma (GBM) progression is still controversial. p62 is
Patrycja Przygodzka et al.
Scientific reports, 9(1), 2165-2165 (2019-02-17)
Epithelial-to-mesenchymal transition (EMT) in cancer cells, represents early stages of metastasis and is a promising target in colorectal cancer (CRC) therapy. There have been many attempts to identify markers and key pathways induced throughout EMT but the process is complex
Yun Zhan et al.
Oncotarget, 8(3), 4629-4641 (2016-11-29)
Metastasis is a multi-step process. Tumor cells occur epithelial-mesenchymal transition (EMT) to start metastasis, then, they need to undergo a reverse progression of EMT, mesenchymal-epithelial transition (MET), to colonize and form macrometastases at distant organs to complete the whole process
Binbin Zhang et al.
Oncology letters, 16(4), 5075-5083 (2018-09-27)
Human laryngeal squamous cell carcinoma (LSCC) is a malignant cancer type. Epithelial-mesenchymal transition marker Snail family transcriptional repressor 1 (SNAI1) is associated with the occurrence, development, invasion and metastasis of numerous tumor types, such as lung, liver and ovarian cancer.
Dong Yeon Kim et al.
Oncotarget, 8(63), 106190-106205 (2018-01-02)
Renal tubulointerstitial fibrosis is an important event in the pathogenesis of diabetic nephropathy. Under pathologic conditions, renal tubular epithelial cells undergo transition characterized by loss of cell-cell adhesion and increased cell migration. This study investigated that eucalyptol inhibited tubular epithelial

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica