Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU026721

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCCTTTGTCAGCCAATCACAGTTTGAAACCTTTGCCCTCTGTTCCAGAAGAGAAAAAGCCCAGGCATAAAATCATCTCCATATTCTCAGGCACAGAGAAAGGAAGTAAAAAGAAAGAAAAGGAACGGCCAGAAATTTCTCCTCCATCTGATTTTGAGCACACCATCCATGTTGGCTTTGATGCTGTTACTGGAGAATTCACTGGCATGCCAGAACAGTGGGCTCGATTACTACAGACCTCCAATATCACCAAACTAGAGCAAAAGAAGAATCCTCAGGCTGTGCTGGATGTCCTAAAGTTCTACGACTCCAACACAGTGAAGCAGAAATATCTGAGCTTTACTCCTCCTGAGAAAGATGGCTTTCCTTCTGGAACACCAGCACTGAATGCCAAGGGAACAGAAGCACCCGCAGTAGT

Ensembl | Número de adesão de ser humano

ENSG00000180370

nº de adesão NCBI

NM_002577

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PAK2(5062) , PAK2(5062)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ting Shuang et al.
FEBS letters, 589(20 Pt B), 3154-3164 (2015-09-13)
MiR-134 has been reported to have a role in the development and progression of various cancers. In this study, we found that miR-134 expression was significantly decreased in chemo-resistant serous epithelial ovarian cancer (EOC) patients. Over-expression of miR-134 enhanced the
Elizabeth Flate et al.
International journal of oncology, 45(4), 1401-1411 (2014-07-23)
The interaction between tumor cells and extracellular matrix (ECM) proteins influences cell migration and the invasive behavior of cancer cells. In this study, we provide experimental evidence that collagen I and fibronectin affect ovarian cancer cell migration. In vitro wound healing assays
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica