Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU023131

Sigma-Aldrich

MISSION® esiRNA

targeting human LAMC2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCAGCTGTCCAGCTTGCTATAATCAAGTGAAGATTCAGATGGATCAGTTTATGCAGCAGCTTCAGAGAATGGAGGCCCTGATTTCAAAGGCTCAGGGTGGTGATGGAGTAGTACCTGATACAGAGCTGGAAGGCAGGATGCAGCAGGCTGAGCAGGCCCTTCAGGACATTCTGAGAGATGCCCAGATTTCAGAAGGTGCTAGCAGATCCCTTGGTCTCCAGTTGGCCAAGGTGAGGAGCCAAGAGAACAGCTACCAGAGCCGCCTGGATGACCTCAAGATGACTGTGGAAAGAGTTCGGGCTCTGGGAAGTCAGTACCAGAACCGAGTTCGGGATACTCACAGGCTCATCACTCAGATGCAGCTGAGCCTGGCAGAAAGTGAAGCTTCCTTGGGAAACACTAACATTCCTGCCTCAGACCACTACGTGGGGCCAAATGGCTTTAAAAGTCTGGCTCAGGAGGCCACAAGATTAGCAGAAAGCCACGTTGAGTCA

Ensembl | Número de adesão de ser humano

ENSG00000058085

nº de adesão NCBI

NM_005562

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LAMC2(3918) , LAMC2(3918)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qiang-Hua Zhou et al.
Cancer management and research, 10, 2983-2995 (2018-09-15)
Molecular biomarkers, especially serologic factors, have been widely applied in cancer diagnosis and patient follow-up. However, there are few valuable prognostic factors in penile squamous cell carcinoma (PSCC). Here, the authors investigated whether laminin gamma 2 (LAMC2) expression, especially serum
Yan Liang et al.
Cell death and differentiation, 25(11), 1980-1995 (2018-03-08)
Esophageal squamous cell carcinoma (ESCC) is the main subtype of esophageal cancer. Long noncoding RNAs (lncRNAs) are thought to play a critical role in cancer development. Recently, lncRNA CASC9 was shown to be dysregulated in many cancer types, but the
Yao-Fei Pei et al.
The American journal of pathology, 189(8), 1637-1653 (2019-07-28)
Cholangiocarcinoma (CCA) is a malignant cancer that is associated with high mortality rates. The relationship between laminin γ 2 chain gene (LAMC2) and epidermal growth factor receptor (EGFR) has been previously documented in gastric cancer and oral squamous cell carcinoma.
Manoj Garg et al.
Scientific reports, 7(1), 9749-9749 (2017-08-31)
Anaplastic thyroid carcinoma (ATC) is one of the most lethal malignancies having no effective treatment. Exportin-1 (XPO1) is the key mediator of nuclear export of many tumor suppressor proteins and is overexpressed in human cancers. In this study, we examined
D O Velez et al.
Nature communications, 8(1), 1651-1651 (2017-11-23)
The topographical organization of collagen within the tumor microenvironment has been implicated in modulating cancer cell migration and independently predicts progression to metastasis. Here, we show that collagen matrices with small pores and short fibers, but not Matrigel, trigger a
Exibir todos os documentos relacionados

Global Trade Item Number

SKUGTIN
EHU023131-50UG4061828334384
EHU023131-20UG4061828569847

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica