Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU019961

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCATG

Ensembl | Número de adesão de ser humano

ENSG00000118503

nº de adesão NCBI

NM_006290

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TNFAIP3(7128) , TNFAIP3(7128)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhipeng Li et al.
Brain, behavior, and immunity, 79, 228-235 (2019-02-11)
Neuroinflammation is now recognized to be a feature of many neurological disorders. More accumulated evidences suggested chrysin which was contained in honey, propolis, vegetables, fruits and plants can exert biological activities including anti-neuroinflammatory effects. However, the precise molecular mechanisms of
Hongjun Zhao et al.
Rheumatology (Oxford, England), 56(5), 835-843 (2017-02-06)
TNF-α-induced protein 3 ( TNFAIP3 ) is one of the major SLE susceptibility genes involved in the regulation of inflammatory responses through modulation of the nuclear factor-κB (NF-κB) pathway. We aim to assess TNFAIP3 expression in CD4 + T cells
Wenjing Feng et al.
Biochemical and biophysical research communications, 482(4), 1107-1113 (2016-12-05)
The innate immune response provides the first line of defense against viruses and other pathogens by responding to specific microbial molecules. A20 is a cytoplasmic ubiquitin-editing protein that negatively regulates the retinoic acid-inducible gene I (RIG-I)-mediated activation of interferon regulatory
Meng Qin et al.
Frontiers in pharmacology, 8, 953-953 (2018-01-10)
Atherosclerosis (AS) is a chronic inflammatory disease and endothelial cell injury is the initial event. In this study, we investigated the protective effects of ginsenoside F1 (GF1) on AS and the potential molecular mechanisms of ox-LDL induced endothelial injury. ApoE-/-
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica