Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU019271

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCAC

Ensembl | Número de adesão de ser humano

ENSG00000170323

nº de adesão NCBI

NM_001442

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FABP4(2167) , FABP4(2167)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IOU
GMU
QCS
NPR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

D J Kim et al.
Journal of dental research, 98(13), 1511-1520 (2019-10-19)
A strong correlation between chronic periodontitis and systemic diseases (e.g., cardiovascular disease, metabolic disorders) has been suggested for several decades. However, the evidence supporting this correlation is restricted primarily to epidemiologic studies, with only a few experimental outcomes confirming such
Ying Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 272-279 (2016-12-05)
FABP4 is widely expressed in both normal and pathologic tissues. It promotes cell proliferation, survival and migration of endothelial cells, and therefore, angiogenesis. However, the role of FABP4 in hemangioma or hemangioma endothelial cells (HemECs) has not been explored. In
U Harjes et al.
Oncogene, 36(7), 912-921 (2016-08-30)
Fatty acid binding protein 4 (FABP4) is a fatty acid chaperone, which is induced during adipocyte differentiation. Previously we have shown that FABP4 in endothelial cells is induced by the NOTCH1 signalling pathway, the latter of which is involved in
Mingguo Huang et al.
Oncotarget, 8(67), 111780-111794 (2018-01-18)
Fatty acid binding protein 4 (FABP4) is an abundant protein in adipocytes, and its production is influenced by high-fat diet (HFD) or obesity. The prostate stromal microenvironment induces proinflammatory cytokine production, which is key for the development and progression of
Sanjay Basak et al.
Molecular and cellular biochemistry, 437(1-2), 55-64 (2017-06-18)
Adequate placental angiogenesis is critical for the establishment of the placental circulation and thus for normal feto-placental growth and development. Fatty acid-binding protein-4 (FABP4) plays a pro-angiogenic role in endothelial cells; however, very little information is available in placental first
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica