Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU015441

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF6

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCCTAGTCCAAAGCGAAGAGTTGTCTGTGTGATGATAGTATTGGCATTTATAATACTGAACTATGGACCTATGAGCATGTTGGAACAGGATTCCAGGAGAATGAACCCTAGTGTGAGCCCTGCAAATCAAAGGAGGCACCTTCTAGGATTTTCTGCTAAAGAGGCACAGGACACATCAGATGGTATTATCCAGAAAAACAGCTACAGATATGATCATTCTGTTTCAAATGACAAAGCCCTGATGGTGCTAACTGAAGAACCATTGCTTTACATTCCTCCACCTCCTTGTCAGCCCCTAATTAACACAACAGAGTCTCTCAGGTTAAATCATGAACTTCGAGGATGGGTTCATAGACATGAAGTAGAAAGGACCAAGTCAAGAAGAATGACAAATAATCAACAGAAAACCCGTATTCTTCAGGGTGCTCTGGAACAGGGCTCAAATTCTCAGCTGATGGCTGTTCAATACACAGAAACCACTAGTAGTATCAGCAGGAACTCAGGGAGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Patricia Freis et al.
Oncotarget, 8(13), 20974-20987 (2017-04-21)
mTOR and Unfolded Protein Response (UPR) are two signaling pathways frequently activated in cancer cells. The mTOR pathway has been shown to be up-regulated in most gastroenteropancreatic neuroendocrine tumors. In contrast, little is known about the UPR status in neoplastic
Weilin Xu et al.
Frontiers in neuroscience, 12, 638-638 (2018-10-05)
Neuronal apoptosis is an important factor accounting for the poor outcomes of intracerebral hemorrhage (ICH). This study first showed that inhibition of activating transcription factor 6 (ATF6) could alleviate secondary brain injury through anti-apoptosis after ICH in rats. Melatonin, ATF6
Rui Zhou et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(5), 2397-2420 (2018-12-12)
Lipid droplets (LDs) are dynamic organelles that store neutral lipids during times of energy excess, and an increased accumulation of LDs in the liver is closely linked to hepatic steatosis. Our previous studies suggested that resveratrol (RSV) supplement could improve
To Sing Fung et al.
Virology, 533, 34-44 (2019-05-15)
Coronavirus infection induces the generation of autophagosomes, and certain host proteins regulating cellular autophagy are hijacked by some coronaviruses to facilitate the formation of double membrane vesicles. However, mechanisms underlying coronavirus-induced autophagy remain largely unknown. In this study, we demonstrate
A M Merlot et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2094-2110 (2019-04-15)
The metastasis suppressor, N-myc downstream regulated gene-1 (NDRG1), is a stress response protein that is involved in the inhibition of multiple oncogenic signaling pathways. Initial studies have linked NDRG1 and the endoplasmic reticulum (ER) stress response. Considering this, we extensively

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica