Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU013561

Sigma-Aldrich

MISSION® esiRNA

targeting human MSH2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCATGGCTGAAATGTTGGAAACTGCTTCTATCCTCAGGTCTGCAACCAAAGATTCATTAATAATCATAGATGAATTGGGAAGAGGAACTTCTACCTACGATGGATTTGGGTTAGCATGGGCTATATCAGAATACATTGCAACAAAGATTGGTGCTTTTTGCATGTTTGCAACCCATTTTCATGAACTTACTGCCTTGGCCAATCAGATACCAACTGTTAATAATCTACATGTCACAGCACTCACCACTGAAGAGACCTTAACTATGCTTTATCAGGTGAAGAAAGGTGTCTGTGATCAAAGTTTTGGGATTCATGTTGCAGAGCTTGCTAATTTCCCTAAGCATGTAATAGAGTGTGCTAAACAGAAAGCCCTGGAACTTGAGGAGTTTCAGTATATTGGAGAATCGCAAGGATATGATATCATGGAACCAGCAGCAAAGAAGTGCTATCTGGAAAGAGAGCAAGGTGAAAAAATTATTCAGGAGTTCCTGTCCAAGGTGAAACAAATGCCCT

Ensembl | Número de adesão de ser humano

ENSG00000095002

nº de adesão NCBI

NM_000251

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MSH2(4436) , MSH2(4436)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ACIU
WXU
QCS
IRS
JRR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lidia Cerquetti et al.
Cancers, 11(11) (2019-11-14)
Mitotane (MTT) is an adrenolytic drug used in adjuvant and advanced treatments of adrenocortical carcinoma (ACC). Ionizing radiation (IR) is also used in adrenal cancer treatment, even though its biological action remains unknown. To provide a reliable in vivo preclinical
Jennifer A McKinney et al.
Nature communications, 11(1), 236-236 (2020-01-15)
Alternative DNA structure-forming sequences can stimulate mutagenesis and are enriched at mutation hotspots in human cancer genomes, implicating them in disease etiology. However, the mechanisms involved are not well characterized. Here, we discover that Z-DNA is mutagenic in yeast as
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica