Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU009401

Sigma-Aldrich

MISSION® esiRNA

targeting human LIFR

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACAGATGCACCTCCCCATTAATTCTACTGTGGAAGATATAGCTGCAGAAGAGGACTTAGATAAAACTGCGGGTTACAGACCTCAGGCCAATGTAAATACATGGAATTTAGTGTCTCCAGACTCTCCTAGATCCATAGACAGCAACAGTGAGATTGTCTCATTTGGAAGTCCATGCTCCATTAATTCCCGACAATTTTTGATTCCTCCTAAAGATGAAGACTCTCCTAAATCTAATGGAGGAGGGTGGTCCTTTACAAACTTTTTTCAGAACAAACCAAACGATTAACAGTGTCACCGTGTCACTTCAGTCAGCCATCTCAATAAGCTCTTACTGCTAGTGTTGCTACATCAGCACTGGGCATTCTTGGAGGGATCCTGTGAAGTATTGTTAGGAGGTGAACTTCACTACATGTTAAGTTACACTGAAAGTGTTCATGTGCTTTTAATGTAGTCTAAAAGCCAAAGTATAGTGACTCAGAATCCTCAATCCACAAAACTCAAGATTGGGAGCTCTTTGTGATCAAGCCAA

Ensembl | Número de adesão de ser humano

ENSG00000113594

nº de adesão NCBI

NM_002310

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LIFR(3977) , LIFR(3977)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qin Luo et al.
Oncotarget, 6(9), 6989-6999 (2015-03-10)
Differential diagnosis of well-differentiated hepatocellular carcinoma (WD-HCC) and high-grade dysplastic nodules (HGDNs) represents a challenge for pathologists. Several immunohistochemistry markers have been identified to distinguish hepatocellular carcinoma (HCC) from HGDNs. However, sensitivity or specificity of the individual marker is still
Chengyong Lei et al.
DNA and cell biology, 37(8), 659-669 (2018-06-15)
The role of leukemia inhibitory factor receptor (LIFR), which is important in the signal transduction of the interleukin-6 cytokine family, is still undefined in clear cell renal cell carcinoma (ccRCC). Thus, we examined the function and mechanism of LIFR in
Hao-Xuan Wu et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2769-2784 (2018-05-12)
Leukemia inhibitory factor receptor (LIFR) has been documented as a cancer promoter and to be present at high levels in various types of tumor tissues. In our search for molecules prognostic of colorectal cancer (CRC), we found high levels of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica