Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU206511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Kdm6b

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGCAGATATGCTGAAGCTCCGGTCACTTAGTGAGGGGCCTCCCAAGGAGCTGAAGATCAGGCTCATCAAGGTGGAAAGTGGGGACAAGGAGACCTTTATCGCCTCTGAGGTGGAAGAGCGGCGGCTGCGCATGGCAGACCTCACCATCAGCCACTGTGCCGCCGATGTCATGCGTGCCAGCAAGAATGCCAAGGTGAAAGGGAAATTCCGAGAGTCCTACCTGTCCCCTGCCCAGTCTGTGAAACCCAAGATCAACACTGAGGAGAAGCTGCCCCGGGAAAAACTCAACCCCCCTACCCCCAGCATCTATTTGGAGAGCAAACGAGATGCCTTCTCGCCGGTCCTGCTACAGTTCTGTACAGACCCCCGGAACCCCATCACCGTCATCAGGGGCCTGGCTGGTTCACTTCGGCTCA

Numéro d'accès Ensembl | souris

ENSMUSG00000018476

Numéro d'accès NCBI

NM_001017426

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... KDM6B(216850) , Kdm6b(216850)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jianchun Wu et al.
Oncology reports, 34(1), 455-460 (2015-05-23)
Mammary stem cells (MSCs) are the progenitor population for human breast epithelia. MSCs give rise during mammary gland development to estrogen receptor (ER)-negative basal cells and the ER- luminal progenitor (LP) population which maintains ER+ and ER- luminal cells. The
Stephanie Dumon et al.
PloS one, 7(8), e43300-e43300 (2012-09-07)
Product of the Itga2b gene, CD41 contributes to hematopoietic stem cell (HSC) and megakaryocyte/platelet functions. CD41 expression marks the onset of definitive hematopoiesis in the embryo where it participates in regulating the numbers of multipotential progenitors. Key to platelet aggregation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique