Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU033871

Sigma-Aldrich

MISSION® esiRNA

targeting human EEF2K

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCAAACTCCTTCCACTTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCTGAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTCACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGAGGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAGTGGAAGGGCGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTGTACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGGCACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGACCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGA

Numéro d'accès Ensembl | humain

ENSG00000103319

Numéro d'accès NCBI

NM_013302

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... EEF2K(29904) , EEF2K(29904)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Y Cheng et al.
Oncogene, 35(49), 6293-6308 (2016-05-18)
Cancer cells predominantly metabolize glucose by glycolysis to produce energy in order to meet their metabolic requirement, a phenomenon known as Warburg effect. Although Warburg effect is considered a peculiarity critical for survival and proliferation of cancer cells, the regulatory
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique