Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU029731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rb1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGGGCTGTGTTGACATCGGAGTACAGCGATATAAACTTGGAGTCCGATTGTATTACCGTGTGATGGAATCCATGCTTAAATCAGAAGAAGAACGTTTGTCCATTCAGAATTTTAGCAAACTCCTAAATGACAACATCTTTCATATGTCTTTACTGGCCTGTGCTCTTGAAGTTGTAATGGCTACGTATAGCAGAAGTACATTGCAGCATCTTGATTCTGGAACAGATTTGTCCTTCCCGTGGATTCTGAACGTACTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATTGAAAGTTTTATCAAAGTGGAAGCCAACTTGACAAGAGAAATGATAAAACATTTAGAAAGATGTGAGCATCGAATCATGGAATCCCTTGCATGGCTTTCAGATTCACCTTTATTTGATCTCATTAAGCAGTCCAAGGATGGAGAAGGACCTGATAACCTTGAACCTGCTTGTCCTC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yi-Xiang Zhang et al.
Molecular cancer therapeutics, 13(9), 2184-2193 (2014-07-17)
Well-differentiated/dedifferentiated liposarcomas (WD/DDLPS) are among the most common subtypes of soft tissue sarcomas. Conventional systemic chemotherapy has limited efficacy and novel therapeutic strategies are needed to achieve better outcomes for patients. The cyclin-dependent kinase 4 (CDK4) gene is highly amplified
Donald J Vander Griend et al.
International journal of biological sciences, 10(6), 627-642 (2014-06-21)
In normal prostate, androgen-dependent androgen receptor (AR) signaling within prostate stromal cells induces their secretion of paracrine factors, termed "andromedins" which stimulate growth of the epithelial cells. The present studies demonstrate that androgen-dependent andromedin-driven growth stimulation is counter-balanced by androgen-induced

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique