Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU184131

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTTGCAAAAGGGGGAAAGTAGTTTGCTGCCTCTTTAAGACTAGGACTGAGAGAAAGAAGAGGAGAGAGAAAGAAAGGGAGAGAAGTTTGAGCCCCAGGCTTAAGCCTTTCCAAAAAATAATAATAACAATCATCGGCGGCGGCAGGATCGGCCAGAGGAGGAGGGAAGCGCTTTTTTTGATCCTGATTCCAGTTTGCCTCTCTCTTTTTTTCCCCCAAATTATTCTTCGCCTGATTTTCCTCGCGGAGCCCTGCGCTCCCGACACCCCCGCCCGCCTCCCCTCCTCCTCTCCCCCCGCCCGCGGGCCCCCCAAAGTCCCGGCCGGGCCGAGGGTCGGCGGCCGCCGGCGGGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAA

Numéro d'accès Ensembl | humain

ENSG00000181449

Numéro d'accès NCBI

NM_003106

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SOX2(6657) , Sox2()

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jiaxuan Chen et al.
Molecular carcinogenesis, 56(10), 2267-2278 (2017-05-26)
Fas signaling promotes colorectal cancer (CRC) metastasis by inducing epithelial-mesenchymal transition (EMT). The acquisition of EMT properties in turn induces stemness but the mechanism by which Fas signaling contributes to it still remains unclear. Hence, the aim of this study
Liang Tang et al.
Pathology oncology research : POR, 24(4), 907-913 (2018-04-06)
Osteosarcoma (OS) was a prevalent malignant bone tumor which threatens people's health worldwide. Wnt/β catenin signaling pathway had been proved significant in various cancers, indicating its possible function in OS as well. Sox2, a crucial member among SOX family could
Tatsuya Ishiguro et al.
Cancer research, 76(1), 150-160 (2015-12-17)
The establishment of cancer stem-like cell (CSC) culture systems may be instrumental in devising strategies to fight refractory cancers. Inhibition of the Rho kinase ROCK has been shown to favorably affect CSC spheroid cultures. In this study, we show how
Keshav Gopal et al.
Oncotarget, 7(3), 3111-3127 (2015-12-20)
We have previously identified a novel intra-tumoral dichotomy in breast cancer based on the differential responsiveness to a Sox2 reporter (SRR2), with cells responsive to SRR2 (RR) being more stem-like than unresponsive cells (RU). Here, we report that RR cells
Nicolas Chassaing et al.
Genome research, 26(4), 474-485 (2016-02-20)
Ocular developmental anomalies (ODA) such as anophthalmia/microphthalmia (AM) or anterior segment dysgenesis (ASD) have an estimated combined prevalence of 3.7 in 10,000 births. Mutations in SOX2 are the most frequent contributors to severe ODA, yet account for a minority of
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique