Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU095701

Sigma-Aldrich

MISSION® esiRNA

targeting human NF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGTTTGGCTGTTATGCAAAGCAGGTGATTTGTCTTAATCAGATAAAAGATAGAGGCTATGGGGGCCTCAAGATTTTTGGAGAGCAGAGGTGGTCTCTGGCAATTCCATCTGGTTTTGAGAAACTTAGCAGCTCACAGAGCACAGAGATCCTGCCTTCTTCCTACTATCAGGCTGACCTAATGGGGTTGGGCTGCTCGGCAACTGCTTGGGTCACCTTGCCCCAAGGAAACCAGCCCTGGGTGCCACCCAGCCACTTAGGGTCTACAGGGTGGGACTCCAGACCTAGAGCGTAAGTATGGATGTTGTGGCCCTGTGTCTTCCTAGTGTGACCCAGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yu Mei et al.
Cell communication and signaling : CCS, 15(1), 34-34 (2017-09-20)
Meningiomas are the most common primary intracranial tumors in adults. While a majority of meningiomas are slow growing neoplasms that may cured by surgical resection, a subset demonstrates more aggressive behavior and insidiously recurs despite surgery and radiation, without effective
Wen-Bin Ou et al.
British journal of cancer, 115(10), 1253-1263 (2016-10-14)
Improved mesothelioma patient survival will require development of novel and more effective pharmacological interventions. TP53 genomic mutations are uncommon in mesothelioma, and recent data indicate that p53 remains functional, and therefore is a potential therapeutic target in these cancers. In
Ramiro Iglesias-Bartolome et al.
Nature cell biology, 17(6), 793-803 (2015-05-12)
Genomic alterations in GNAS, the gene coding for the Gαs heterotrimeric G protein, are associated with a large number of human diseases. Here, we explored the role of Gαs on stem cell fate decisions by using the mouse epidermis as
Xianle Shi et al.
Development (Cambridge, England), 144(21), 3957-3967 (2017-09-28)
The Hippo pathway modulates the transcriptional activity of Yap to regulate the differentiation of the inner cell mass (ICM) and the trophectoderm (TE) in blastocysts. Yet how Hippo signaling is differentially regulated in ICM and TE cells is poorly understood.
Upal Basu-Roy et al.
Nature communications, 6, 6411-6411 (2015-04-04)
The repressive Hippo pathway has a profound tumour suppressive role in cancer by restraining the growth-promoting function of the transcriptional coactivator, YAP. We previously showed that the stem cell transcription factor Sox2 maintains cancer stem cells (CSCs) in osteosarcomas. We

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique