Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU067731

Sigma-Aldrich

MISSION® esiRNA

targeting human HUWE1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATCTTGGGCAAGTCAGTCAGATATACAGATATGGAGAGTGAAGATTACCACTTCTACCAAGGTCTGGTTTATCTGCTGGAAAATGATGTCTCCACACTAGGCTATGACCTCACCTTCAGCACTGAGGTCCAAGAGTTTGGAGTTTGTGAAGTTCGTGACCTCAAACCCAATGGGGCCAACATCTTGGTAACAGAGGAGAATAAGAAGGAGTATGTACACCTGGTATGCCAGATGAGAATGACAGGAGCCATCCGCAAGCAGTTGGCGGCTTTCTTAGAAGGCTTCTATGAGATCATTCCAAAGCGCCTCATTTCCATCTTCACTGAGCAGGAGTTAGAGCTGCTTATATCAGGACTGCCCACCATTGACATCGATGATCTGAAATCCAACACTGAATACCACAAGTACCAGTCCAACTCTATTCAGATCCAGTGGTTCTGGAGAGCATTGCGTTCTTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Michael J Friez et al.
BMJ open, 6(4), e009537-e009537 (2016-05-01)
X linked intellectual disability (XLID) syndromes account for a substantial number of males with ID. Much progress has been made in identifying the genetic cause in many of the syndromes described 20-40 years ago. Next generation sequencing (NGS) has contributed to
Matthias Bosshard et al.
Scientific reports, 7(1), 15050-15050 (2017-11-10)
Mutations in the HECT, UBA and WWE domain-containing 1 (HUWE1) E3 ubiquitin ligase cause neurodevelopmental disorder X-linked intellectual disability (XLID). HUWE1 regulates essential processes such as genome integrity maintenance. Alterations in the genome integrity and accumulation of mutations have been
Dong Yang et al.
Theranostics, 8(13), 3517-3529 (2018-07-22)
Lung cancer is the most frequent cancer type and the leading cause of tumor-associated deaths worldwide. TP53 is an important tumor suppressor gene and is frequently inactivated in lung cancer. E3 ligases targeting p53, such as MDM2, are involved in
A Rolfo et al.
Cell death & disease, 3, e305-e305 (2012-05-04)
The E3 ubiquitin ligase MULE (Mcl-1 Ubiquitin Ligases E3) targets myeloid cell leukemia factor 1 (Mcl-1) and tumor suppressor p53 for proteasomal degradation. Although Mcl-1 and p53 have been implicated in trophoblast cell death in preeclampsia (PE) and intrauterine growth
Lisa J Crawford et al.
Oncogene, 39(27), 5001-5014 (2020-06-12)
Proteasome inhibitors have provided a significant advance in the treatment of multiple myeloma (MM). Consequently, there is increasing interest in developing strategies to target E3 ligases, de-ubiquitinases, and/or ubiquitin receptors within the ubiquitin proteasome pathway, with an aim to achieve

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique