Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU030431

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTACCTTCCAGCAGCCCTACGACCAGGCCCACCTGCTGGCAGCCATCCCACCTCCGGAGATCCTCAACCCCACCGCCTCGCTGCCAATGCTCATCTGGGACTCTGTCCTGGCGCCCCAAGCCCAGCCAATTGCCTGGGCCTCCCTTCGGCTCCAGGAGAGTCCCAGGGTGGCAGAGCTGACCTCCCTGTCAGATGAGGACAGTGGGAAAGGCTCCCAGCCCCCCAGCCCACCCTCACCGGCTCCTTCGTCCTTCTCCTCTACTTCAGTCTCTTCCTTGGAGGCCGAGGCCTATGCTGCCTTCCCAGGCTTGGGCCAAGTGCCCAAGCAGCTGGCCCAGCTCTCTGAGGCCAAGGATCTCCAGGCTCGAAAGGCCTTCAACTGCAAATACTGCAACAAGGAATACCTCAGCCTGG

Numéro d'accès Ensembl | humain

ENSG00000124216

Numéro d'accès NCBI

NM_005985

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SNAI1(6615) , SNAI1(6615)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hong Li et al.
Theranostics, 9(7), 1909-1922 (2019-05-01)
Rationale: Glioblastoma (GBM) is the most common and aggressive brain tumor, characterized by its propensity to invade the surrounding brain parenchyma. The effect of extracellular high-mobility group box 1 (HMGB1) protein on glioblastoma (GBM) progression is still controversial. p62 is
Patrycja Przygodzka et al.
Scientific reports, 9(1), 2165-2165 (2019-02-17)
Epithelial-to-mesenchymal transition (EMT) in cancer cells, represents early stages of metastasis and is a promising target in colorectal cancer (CRC) therapy. There have been many attempts to identify markers and key pathways induced throughout EMT but the process is complex
Yun Zhan et al.
Oncotarget, 8(3), 4629-4641 (2016-11-29)
Metastasis is a multi-step process. Tumor cells occur epithelial-mesenchymal transition (EMT) to start metastasis, then, they need to undergo a reverse progression of EMT, mesenchymal-epithelial transition (MET), to colonize and form macrometastases at distant organs to complete the whole process
Binbin Zhang et al.
Oncology letters, 16(4), 5075-5083 (2018-09-27)
Human laryngeal squamous cell carcinoma (LSCC) is a malignant cancer type. Epithelial-mesenchymal transition marker Snail family transcriptional repressor 1 (SNAI1) is associated with the occurrence, development, invasion and metastasis of numerous tumor types, such as lung, liver and ovarian cancer.
Dong Yeon Kim et al.
Oncotarget, 8(63), 106190-106205 (2018-01-02)
Renal tubulointerstitial fibrosis is an important event in the pathogenesis of diabetic nephropathy. Under pathologic conditions, renal tubular epithelial cells undergo transition characterized by loss of cell-cell adhesion and increased cell migration. This study investigated that eucalyptol inhibited tubular epithelial
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique