Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU015441

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCCTAGTCCAAAGCGAAGAGTTGTCTGTGTGATGATAGTATTGGCATTTATAATACTGAACTATGGACCTATGAGCATGTTGGAACAGGATTCCAGGAGAATGAACCCTAGTGTGAGCCCTGCAAATCAAAGGAGGCACCTTCTAGGATTTTCTGCTAAAGAGGCACAGGACACATCAGATGGTATTATCCAGAAAAACAGCTACAGATATGATCATTCTGTTTCAAATGACAAAGCCCTGATGGTGCTAACTGAAGAACCATTGCTTTACATTCCTCCACCTCCTTGTCAGCCCCTAATTAACACAACAGAGTCTCTCAGGTTAAATCATGAACTTCGAGGATGGGTTCATAGACATGAAGTAGAAAGGACCAAGTCAAGAAGAATGACAAATAATCAACAGAAAACCCGTATTCTTCAGGGTGCTCTGGAACAGGGCTCAAATTCTCAGCTGATGGCTGTTCAATACACAGAAACCACTAGTAGTATCAGCAGGAACTCAGGGAGT

Numéro d'accès Ensembl | humain

ENSG00000118217

Numéro d'accès NCBI

NM_007348

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATF6(22926) , ATF6(22926)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Patricia Freis et al.
Oncotarget, 8(13), 20974-20987 (2017-04-21)
mTOR and Unfolded Protein Response (UPR) are two signaling pathways frequently activated in cancer cells. The mTOR pathway has been shown to be up-regulated in most gastroenteropancreatic neuroendocrine tumors. In contrast, little is known about the UPR status in neoplastic
Weilin Xu et al.
Frontiers in neuroscience, 12, 638-638 (2018-10-05)
Neuronal apoptosis is an important factor accounting for the poor outcomes of intracerebral hemorrhage (ICH). This study first showed that inhibition of activating transcription factor 6 (ATF6) could alleviate secondary brain injury through anti-apoptosis after ICH in rats. Melatonin, ATF6
Rui Zhou et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(5), 2397-2420 (2018-12-12)
Lipid droplets (LDs) are dynamic organelles that store neutral lipids during times of energy excess, and an increased accumulation of LDs in the liver is closely linked to hepatic steatosis. Our previous studies suggested that resveratrol (RSV) supplement could improve
To Sing Fung et al.
Virology, 533, 34-44 (2019-05-15)
Coronavirus infection induces the generation of autophagosomes, and certain host proteins regulating cellular autophagy are hijacked by some coronaviruses to facilitate the formation of double membrane vesicles. However, mechanisms underlying coronavirus-induced autophagy remain largely unknown. In this study, we demonstrate
A M Merlot et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2094-2110 (2019-04-15)
The metastasis suppressor, N-myc downstream regulated gene-1 (NDRG1), is a stress response protein that is involved in the inhibition of multiple oncogenic signaling pathways. Initial studies have linked NDRG1 and the endoplasmic reticulum (ER) stress response. Considering this, we extensively

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique