Direkt zum Inhalt
Merck

EHU088101

Sigma-Aldrich

MISSION® esiRNA

targeting human VCL

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Stephen G Turney et al.
Molecular biology of the cell, 27(3), 500-517 (2015-12-04)
Nerve growth factor (NGF) promotes growth, differentiation, and survival of sensory neurons in the mammalian nervous system. Little is known about how NGF elicits faster axon outgrowth or how growth cones integrate and transform signal input to motor output. Using
Beenu Moza Jalali et al.
Theriogenology, 116, 17-27 (2018-05-16)
During early pregnancy, uterine epithelial cells undergo major transformations in their cytoskeleton that make the endometrium receptive for conceptus attachment. Actin binding proteins (ABPs) such as cofilin, gelsolin, and vinculin are involved in regulating actin polymerization, severing or crosslinking actin
Fangjia Li et al.
Scientific reports, 9(1), 5615-5615 (2019-04-06)
This study utilized a Förster resonance energy transfer (FRET)-based molecular tension sensor and live cell imaging to evaluate the effect of osteocytes, a mechanosensitive bone cell, on the migratory behavior of tumor cells. Two cell lines derived from MDA-MB-231 breast
Tanchen Ren et al.
Biomaterials, 56, 58-67 (2015-05-03)
Selective enhancement of directional migration of Schwann cells (SCs) over fibroblasts (FIBs) plays a significant role in peripheral nerve regeneration, because this behavior facilitates neuron repair and avoids fibrosis. Herein a complementary density gradient of poly(3-dimethyl-methacryloyloxyethyl ammonium propane sulfonate) (PDMAPS
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though

Artikel

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.