Direkt zum Inhalt
Merck

EHU066851

Sigma-Aldrich

MISSION® esiRNA

targeting human PYCARD

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTTGGACCTCACCGACAAGCTGGTCAGCTTCTACCTGGAGACCTACGGCGCCGAGCTCACCGCTAACGTGCTGCGCGACATGGGCCTGCAGGAGATGGCCGGGCAGCTGCAGGCGGCCACGCACCAGGGCCTGCACTTTATAGACCAGCACCGGGCTGCGCTTATCGCGAGGGTCACAAACGTTGAGTGGCTGCTGGATGCTCTGTACGGGAAGGTCCTGACGGATGAGCAGTACCAGGCAGTGCGGGCCGAGCCCACCAACCCAAGCAAGATGCGGAAGCTCTTCAGTTTCACACCAGCCTGGAACTGGACCTGCAAGGACTTGCTCCTCCAGGCCCTAAGGGAGTCCCAGTCCTACCTGGTGGAGGACCTGGAGCGGAGCTGAGGCTCCTTCCCAGCAACACTCCGGTCAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lanny Gov et al.
mBio, 4(4) (2013-07-11)
Interleukin-1β (IL-1β) functions as a key regulator of inflammation and innate immunity. The protozoan parasite Toxoplasma gondii actively infects human blood monocytes and induces the production of IL-1β; however, the host and parasite factors that mediate IL-1β production during T.
Mairaj Ahmed Ansari et al.
PLoS pathogens, 11(7), e1005019-e1005019 (2015-07-03)
The IL-1β and type I interferon-β (IFN-β) molecules are important inflammatory cytokines elicited by the eukaryotic host as innate immune responses against invading pathogens and danger signals. Recently, a predominantly nuclear gamma-interferon-inducible protein 16 (IFI16) involved in transcriptional regulation has
Minda Zhang et al.
Journal of cellular physiology, 234(11), 20161-20173 (2019-04-07)
The human absent in melanoma 2 (AIM2) is considered as a DNA recognizer. AIM2 has been described as a tumor suppressor gene in the early years. But recent studies suggested that it functions as an oncogene in several cancers. However
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Fushan Shi et al.
Journal of neuroinflammation, 9, 73-73 (2012-04-26)
Prion diseases are neurodegenerative disorders characterized by the accumulation of an abnormal disease-associated prion protein, PrPSc. In prion-infected brains, activated microglia are often present in the vicinity of PrPSc aggregates, and microglial activation is thought to play a key role

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.