Direkt zum Inhalt
Merck

EHU059231

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AATTCCAAACCGGATGAGTGGTGAATGCCAATCCCCACACTGCCCTGGGACTAGTGCAGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCTGACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGCACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTCCACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAGCAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCCCGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Saburo Ito et al.
Autophagy, 11(3), 547-559 (2015-02-26)
Cigarette smoke (CS)-induced mitochondrial damage with increased reactive oxygen species (ROS) production has been implicated in COPD pathogenesis by accelerating senescence. Mitophagy may play a pivotal role for removal of CS-induced damaged mitochondria, and the PINK1 (PTEN-induced putative kinase 1)-PARK2
Zhengjun Gao et al.
Nature communications, 8(1), 1805-1805 (2017-11-29)
Macrophages, dendritic cells and other innate immune cells are involved in inflammation and host defense against infection. Metabolic shifts in mitochondrial dynamics may be involved in Toll-like receptor agonist-mediated inflammatory responses and immune cell polarization. However, whether the mitochondrial morphology
Vinay Choubey et al.
Autophagy, 10(6), 1105-1119 (2014-06-01)
The autophagy protein BECN1/Beclin 1 is known to play a central role in autophagosome formation and maturation. The results presented here demonstrate that BECN1 interacts with the Parkinson disease-related protein PARK2. This interaction does not require PARK2 translocation to mitochondria
Pedro Elói Antunes Dionísio et al.
Molecular neurobiology, 56(4), 2990-3004 (2018-08-04)
Parkin is an E3 ubiquitin ligase involved in Parkinson's disease (PD). Necroptosis is a regulated form of cell death that depends on receptor interacting protein 1 (RIP1) and 3 (RIP3). Importantly, parkin has been implicated in ubiquitination events that can

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.