Direkt zum Inhalt
Merck

EHU058661

Sigma-Aldrich

MISSION® esiRNA

targeting human ROBO2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTCCTCCAGATCACCAGAATGGAATTATCCAAGAATACAAGATCTGGTGTCTAGGAAATGAAACGCGATTCCATATCAACAAAACTGTGGATGCAGCCATTCGGTCCGTAATAATTGGTGGATTATTCCCAGGTATTCAATACCGGGTAGAGGTTGCAGCTAGTACCAGTGCAGGGGTTGGAGTAAAGAGTGAGCCACAGCCAATAATAATCGGGAGACGCAATGAAGTTGTCATTACTGAAAACAATAACAGCATAACTGAGCAAATCACTGATGTGGTGAAGCAACCAGCCTTTATAGCTGGTATTGGTGGTGCCTGCTGGGTAATTCTGATGGGTTTTAGCATATGGTTGTATTGGCGAAGAAAGAAGAGGAAGGGACTCAGTAATTATGCTGTTACGTTTCAAAGAGGAGATGGAGGACTAATGAGCAATGGAAGCCGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tian-Ping Chen et al.
Molecular medicine (Cambridge, Mass.), 27(1), 21-21 (2021-03-05)
Studies have found that circular RNAs (circRNAs) play key roles in cardiovascular diseases. However, the function of circROBO2 in acute myocardial infarction (AMI) is unclear. This study aimed to investigate the pathogenesis of circROBO2 in AMI. qRT-PCR and Western blot
Zhiping Zeng et al.
Life sciences, 203, 39-47 (2018-04-17)
Slit/Robo signaling was originally identified as a repulsive guidance cue in regulating axon branching and neuronal migration. Hepatic stellate cells (HSCs) are the key fibrogenic cells in the liver, which are migratory when activated, and express neural crest markers. The
Gael Genet et al.
Nature communications, 10(1), 2350-2350 (2019-05-30)
Endothelial cell migration, proliferation and survival are triggered by VEGF-A activation of VEGFR2. However, how these cell behaviors are regulated individually is still unknown. Here we identify Endophilin-A2 (ENDOA2), a BAR-domain protein that orchestrates CLATHRIN-independent internalization, as a critical mediator
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.