Direkt zum Inhalt
Merck

EHU050101

Sigma-Aldrich

MISSION® esiRNA

targeting human PARP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CACTCATGCAACCACACACAATGCGTATGACTTGGAAGTCATCGATATCTTTAAGATAGAGCGTGAAGGCGAATGCCAGCGTTACAAGCCCTTTAAGCAGCTTCATAACCGAAGATTGCTGTGGCACGGGTCCAGGACCACCAACTTTGCTGGGATCCTGTCCCAGGGTCTTCGGATAGCCCCGCCTGAAGCGCCCGTGACAGGCTACATGTTTGGTAAAGGGATCTATTTCGCTGACATGGTCTCCAAGAGTGCCAACTACTGCCATACGTCTCAGGGAGACCCAATAGGCTTAATCCTGTTGGGAGAAGTTGCCCTTGGAAACATGTATGAACTGAAGCACGCTTCACATATCAGCAAGTTACCCAAGGGCAAGCACAGTGTCAAAGGTTTGGGCAAAAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Monica E Wielgos et al.
Molecular cancer therapeutics, 17(5), 921-930 (2018-03-30)
HER2-targeted therapies, such as trastuzumab, have increased the survival rates of HER2+ breast cancer patients. However, despite these therapies, many tumors eventually develop resistance to these therapies. Our lab previously reported an unexpected sensitivity of HER2+ breast cancer cells to
Hogyoung Kim et al.
Journal of translational medicine, 13, 233-233 (2015-07-18)
We and others have extensively investigated the role of PARP-1 in cell growth and demise in response to pathophysiological cues. Most of the clinical trials on PARP inhibitors are targeting primarily estrogen receptor (ER) negative cancers with BRCA-deficiency. It is
Zhuoyu Gu et al.
Journal of hematology & oncology, 11(1), 115-115 (2018-09-16)
Recently, many potential prognostic biomarkers for gastric cancer (GC) have been identified, but the prognosis of advanced GC patients remains poor. Chloride channels are promising cancer biomarkers, and their family member chloride channel-3 (CLC-3) is involved in multiple biological behaviors.
Manish Mishra et al.
Biochimica et biophysica acta, 1863(7), 1761-1769 (2017-05-10)
In diabetes, matrix metalloproteinase-9 (MMP-9) is activated, which damages mitochondria, resulting in accelerated capillary cell apoptosis. Regulation of MMP-9 is controlled by multiple transcription factors including nuclear factor-kB (NF-kB) and activator protein-1 (AP-1). Binding of these transcription factors, however, can
Qianghua Xia et al.
Diabetologia, 59(11), 2360-2368 (2016-08-20)
One of the most strongly associated type 2 diabetes loci reported to date resides within the TCF7L2 gene. Previous studies point to the T allele of rs7903146 in intron 3 as the causal variant at this locus. We aimed to

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.