Direkt zum Inhalt
Merck

EHU048791

Sigma-Aldrich

MISSION® esiRNA

targeting human GCLC

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAGCTTCCAAGTCCCTCTTCTTTCCAGATGAAGCAATAAACAAGCACCCTCGCTTCAGTACCTTAACAAGAAATATCCGACATAGGAGAGGAGAAAAGGTTGTCATCAATGTACCAATATTTAAGGACAAGAATACACCATCTCCATTTATAGAAACATTTACTGAGGATGATGAAGCTTCAAGGGCTTCTAAGCCGGATCATATTTACATGGATGCCATGGGATTTGGAATGGGCAATTGCTGTCTCCAGGTGACATTCCAAGCCTGCAGTATATCTGAGGCCAGATACCTTTATGATCAGTTGGCTACTATCTGTCCAATTGTTATGGCTTTGAGTGCTGCATCTCCCTTTTACCGAGGCTATGTGTCAGACATTGATTGTCGCTGGGGAGTGATTTCTGCATCTGTAGATGATAGAACTCGGGAGGAGCGAGGACTGGAGCCATTGAAGAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Preeti Kanikarla-Marie et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(6), 2160-2170 (2015-11-26)
Type 1 diabetic (T1D) patients have a higher incidence of liver disease. T1D patients frequently experience elevated plasma ketone levels along with hyperglycemia. However, no study has examined whether hyperketonemia per se has any role in excess liver damage in
Dulani Wimalachandra et al.
Biochimica et biophysica acta, 1863(1), 71-80 (2017-10-21)
Endometriosis is a disease characterized by regurgitated lesions which are invasive and migratory, embedding at ectopic, extra-uterine locations. Extracellular glucosylceramides (GlcCers), bioactive sphingolipids potentiating signals for cell migration, are found in elevated levels in endometriosis; however underlying mechanisms that result
Arunkumar E Achari et al.
Archives of biochemistry and biophysics, 630, 54-65 (2017-08-02)
Diabetic patients have lower blood levels of l-cysteine (LC) and glutathione (GSH). This study examined the hypothesis that LC supplementation positively up regulates the effects of insulin on GSH and glucose metabolism in 3T3-L1 adipocyte model. 3T3L1 adipocytes were treated
Xiaoxiao Yang et al.
The Journal of biological chemistry, 290(36), 21788-21799 (2015-07-19)
The glutathione (GSH)-dependent antioxidant system has been demonstrated to inhibit atherosclerosis. Macrophage CD36 uptakes oxidized low density lipoprotein (oxLDL) thereby facilitating foam cell formation and development of atherosclerosis. It remains unknown if GSH can influence macrophage CD36 expression and cellular

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.