Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU033441

Sigma-Aldrich

MISSION® esiRNA

targeting human XPC

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGTTTCAATAAAGGGGTCCATGAGGACACACACAAGGTTCACCTTCTCTGCCTGCTAGCAAATGGCTTCTATCGAAATAACATCTGCAGCCAGCCAGATCTGCATGCTATTGGCCTGTCCATCATCCCAGCCCGCTTTACCAGAGTGCTGCCTCGAGATGTGGACACCTACTACCTCTCAAACCTGGTGAAGTGGTTCATTGGAACATTTACAGTTAATGCAGAACTTTCAGCCAGTGAACAAGATAACCTGCAGACTACATTGGAAAGGAGATTTGCTATTTACTCTGCTCGAGATGATGAGGAATTGGTCCATATATTCTTACTGATTCTCCGGGCTCTGCAGCTCTTGACCCGGCTGGTATTGTCTCTACAGCCAATTCCTCTGAAGTCAGCAACAGCAAAGGGAAAGA

Ensembl | Human Hinterlegungsnummer

ENSG00000154767

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... XPC(7508) , XPC(7508)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Timothy Budden et al.
BMC cancer, 18(1), 100-100 (2018-01-28)
Melanoma has two key features, an over-representation of UV-induced mutations and resistance to DNA damaging chemotherapy agents. Both of these features may result from dysfunction of the nucleotide excision repair pathway, in particular the DNA damage detection branch, global genome
Jyh-Cheng Chen et al.
Pharmacology, 102(1-2), 91-104 (2018-06-29)
Etoposide (VP16) is a topoisomerase II inhibitor and has been used for the treatment of non-small cell lung cancer (NSCLC). Xeroderma pigmentosum complementation group C (XPC) protein is a DNA damage recognition factor in nucleotide excision repair and involved in
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine
Jyh-Cheng Chen et al.
Toxicology research, 7(6), 1247-1256 (2018-12-18)
Astaxanthin has been demonstrated to exhibit a wide range of beneficial effects that include anti-cancer and anti-inflammatory properties. Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair and is involved in
Tiantian Cui et al.
Oncotarget, 6(12), 10060-10072 (2015-04-15)
Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair. Deletion of XPC is associated with early stages of human lung carcinogenesis, and reduced XPC mRNA levels predict poor patient outcome for

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.