Direkt zum Inhalt
Merck

EHU025821

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1B

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGTTAACCCGGGACTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGCGCAAGTGGAATTTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGTACGAGTGGCAAGAGGTGGAGAAGGGCAGCTTGCCCGAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGGTGCCTGCAAGGTGCCGGCGCAGGAGAGCCAGGATGTCAGCGGGAGCCGCCCGGCGGCGCCTTTAATTGGGGCTCCGGCTAACTCTGAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGCCAGACGGGGTTAGCGGAGCAATGCGCAGGAATAAGGAAGCGACCTGCAACCGACGATTCTTCTACTCAAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCAAATGCCGGTTCTGTGGAGCAGACGCCCAAGAAGCCTGGCCTCAGAAGACGTCAAACGTAAACAGCTCG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Galit Ankri-Eliahoo et al.
Journal of vascular surgery, 63(5), 1351-1359 (2015-02-24)
The natural response to arterial occlusive disease is enlargement of collaterals; however, the molecular factors that control collateralization are not well understood. The gene p27(Kip1) (p27) affects human response to arterial injury. Previous studies have shown that overexpression of p27
Alessandra Verdina et al.
Journal of translational medicine, 6, 27-27 (2008-05-24)
Nonsteroidal anti-inflammatory drugs (NSAIDs) have been proposed for prevention and treatment of a variety of human cancers. Piroxicam, in particular, has been recently shown to exert significant anti-tumoral activity in combination with cisplatin (CDDP) on mesothelioma cells. However, the mechanisms
Huimin Wang et al.
Oncology research, 25(9), 1431-1440 (2017-01-22)
Nasopharyngeal carcinoma (NPC) is a common malignancy of the head and neck that arises from the nasopharynx epithelium and is highly invasive. Cyclin-dependent kinase inhibitor 3 (CDKN3) belongs to the dual-specificity protein phosphatase family, which plays a key role in
Takayuki Satoh et al.
Scientific reports, 6, 27829-27829 (2016-06-11)
Potent anti-cancer compounds FR901464 and its methyl-ketal derivative spliceostatin A (SSA) inhibit cell cycle progression at G1 and G2/M phases. These compounds bind to the spliceosome and inhibit the splicing reaction. However, the molecular mechanism underlying G1 arrest after SSA
Ela Alcántara-Flores et al.
Molecules (Basel, Switzerland), 20(12), 21125-21137 (2015-12-04)
Argentatin B has been shown to inhibit the growth of colon HCT-15, and prostate PC-3 cancer cells. However, the mechanism by which argentatin B inhibits cell proliferation is still unknown. We aimed to investigate the mechanism by which argentatin B

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.