Direkt zum Inhalt
Merck

EHU019541

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTTAGCACGGCTCTGGAAACACGCAAACCCTGGTGGTCCCATTTATTTCCTAAAGGGTCTGTCTCACCTCCACATCCTTAACTTGGAGTCCAACGGCTTTGACGAGATCCCAGTTGAGGTCTTCAAGGATTTATTTGAACTAAAGATCATCGATTTAGGATTGAATAATTTAAACACACTTCCAGCATCTGTCTTTAATAATCAGGTGTCTCTAAAGTCATTGAACCTTCAGAAGAATCTCATAACATCCGTTGAGAAGAAGGTTTTCGGGCCAGCTTTCAGGAACCTGACTGAGTTAGATATGCGCTTTAATCCCTTTGATTGCACGTGTGAAAGTATTGCCTGGTTTGTTAATTGGATTAACGAGACCCATACCAACATCCCTGAGCTGTCAAGCCACTACCTTTGCAACACTCCACCTCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaoxiao Yu et al.
Cell journal, 22(3), 325-333 (2019-12-22)
This study aimed to evaluate the specific roles of polyinosinic:polycytidylic acid (polyI:C) in macrophage chemotaxis and reveal the potential regulatory mechanisms related to chemokine receptor 5 (CCR5). In this experimental study, THP-1-derived macrophages (THP1-Mφs) induced from THP- 1 monocytes were
Radhashree Maitra et al.
Oncotarget, 8(21), 35138-35153 (2017-04-20)
New therapeutic interventions are essential for improved management of patients with metastatic colorectal cancer (mCRC). This is especially critical for those patients whose tumors harbor a mutation in the KRAS oncogene (40-45% of all patients). This patient cohort is excluded
Maya O Tree et al.
Virology, 497, 81-91 (2016-07-20)
Arboviruses are a large group of viruses that are transmitted by arthropods including ticks and mosquitoes. The global diversity of arboviruses is unknown; however, theoretical studies have estimated that over 2,000 mosquito-borne flaviviruses may exist. An increasing number of flaviviruses
Ye Liu et al.
Journal of cellular biochemistry, 120(6), 9532-9538 (2018-12-07)
To investigate the effect and mechanism of microRNA-186-5p (miR-186-5p) on the apoptosis in high glucose (HG)-treated cardiomyocytes. Diabetic cardiomyopathy model was established in cardiomyocytes by stimulating with HG. The expressions of miR-186-5p and toll-like receptor 3 (TLR3) were detected by
Zengguang Xu et al.
Cancer cell international, 14, 80-80 (2014-01-01)
Therapeutic options for patients with non-small cell lung cancer (NSCLC) are often restricted to systemic chemotherapy. However, the molecular and cellular processes during chemotherapy of advanced NSCLC patients still remain unclear. Here we investigated the stimulatory activity of plasma in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.