Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

View All Documentation

EHU015441

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCCTAGTCCAAAGCGAAGAGTTGTCTGTGTGATGATAGTATTGGCATTTATAATACTGAACTATGGACCTATGAGCATGTTGGAACAGGATTCCAGGAGAATGAACCCTAGTGTGAGCCCTGCAAATCAAAGGAGGCACCTTCTAGGATTTTCTGCTAAAGAGGCACAGGACACATCAGATGGTATTATCCAGAAAAACAGCTACAGATATGATCATTCTGTTTCAAATGACAAAGCCCTGATGGTGCTAACTGAAGAACCATTGCTTTACATTCCTCCACCTCCTTGTCAGCCCCTAATTAACACAACAGAGTCTCTCAGGTTAAATCATGAACTTCGAGGATGGGTTCATAGACATGAAGTAGAAAGGACCAAGTCAAGAAGAATGACAAATAATCAACAGAAAACCCGTATTCTTCAGGGTGCTCTGGAACAGGGCTCAAATTCTCAGCTGATGGCTGTTCAATACACAGAAACCACTAGTAGTATCAGCAGGAACTCAGGGAGT

Ensembl | Human Hinterlegungsnummer

ENSG00000118217

NCBI-Hinterlegungsnummer

NM_007348

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... ATF6(22926) , ATF6(22926)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Patricia Freis et al.
Oncotarget, 8(13), 20974-20987 (2017-04-21)
mTOR and Unfolded Protein Response (UPR) are two signaling pathways frequently activated in cancer cells. The mTOR pathway has been shown to be up-regulated in most gastroenteropancreatic neuroendocrine tumors. In contrast, little is known about the UPR status in neoplastic
Weilin Xu et al.
Frontiers in neuroscience, 12, 638-638 (2018-10-05)
Neuronal apoptosis is an important factor accounting for the poor outcomes of intracerebral hemorrhage (ICH). This study first showed that inhibition of activating transcription factor 6 (ATF6) could alleviate secondary brain injury through anti-apoptosis after ICH in rats. Melatonin, ATF6
Rui Zhou et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(5), 2397-2420 (2018-12-12)
Lipid droplets (LDs) are dynamic organelles that store neutral lipids during times of energy excess, and an increased accumulation of LDs in the liver is closely linked to hepatic steatosis. Our previous studies suggested that resveratrol (RSV) supplement could improve
To Sing Fung et al.
Virology, 533, 34-44 (2019-05-15)
Coronavirus infection induces the generation of autophagosomes, and certain host proteins regulating cellular autophagy are hijacked by some coronaviruses to facilitate the formation of double membrane vesicles. However, mechanisms underlying coronavirus-induced autophagy remain largely unknown. In this study, we demonstrate
A M Merlot et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(9), 2094-2110 (2019-04-15)
The metastasis suppressor, N-myc downstream regulated gene-1 (NDRG1), is a stress response protein that is involved in the inhibition of multiple oncogenic signaling pathways. Initial studies have linked NDRG1 and the endoplasmic reticulum (ER) stress response. Considering this, we extensively

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.