Skip to Content
Merck
All Photos(1)

Key Documents

EMU069731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ror1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAATCCACCTCCCAGTATCCGCTGGTTCAAGAATGATGCACCTGTGGTCCAAGAACCTCGGAGAATCTCCTTCCGGGCAACCAACTATGGCTCTCGGCTGCGGATTAGAAACCTTGACACCACAGACACTGGTTACTTCCAGTGTGTGGCAACAAATGGCAAGAAAGTGGTGTCTACCACTGGTGTCCTGTTTGTCAAATTTGGGCCTCCTCCGACCGCAAGCCCAGGATCCTCAGATGAGTATGAAGAAGATGGATTCTGTCAGCCGTACCGAGGCATTGCATGTGCACGATTTATTGGCAACCGCACTGTGTATATGGAGTCTTTGCATATGCAGGGGGAAATAGAAAATCAGATCACAGCTGCCTTCACCATGATTGGCACCTCCAGCCATTTATCTGATAAGTGCTCTCAGTTCGCCAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Annalen Bleckmann et al.
Clinical & experimental metastasis, 33(4), 309-323 (2016-02-11)
Liver metastasis development in breast cancer patients is common and confers a poor prognosis. So far, the prognostic significance of surgical resection and clinical relevance of biomarker analysis in metastatic tissue have barely been investigated. We previously demonstrated an impact
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service