Skip to Content
Merck
All Photos(1)

Key Documents

EMU044061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ctcf

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGCAGAGCATTCAGAACAGTGACCCTCCTGAGGAATCATCTGAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCGATATGGCCTTTGTGACCAGTGGAGAATTGGTGCGGCATCGTCGTTATAAACACACTCATGAGAAACCATTTAAGTGTTCCATGTGTGATTATGCCAGTGTAGAAGTCAGCAAATTAAAACGACACATTCGCTCTCATACTGGAGAGCGCCCGTTCCAGTGCAGTTTGTGCAGTTATGCCAGCAGGGACACATACAAGCTGAAAAGGCATATGAGAACCCATTCAGGGGAAAAACCTTATGAATGTTATATTTGTCACGCTCGGTTTACCCAGAGTGGTACCATGAAGATGCACATTTTACAGAAGCACACAGAAAATGTGGCCAAATTTCATTGTCCCCATTGTGACACTGTCATAGCCCGAAAAAGTGATTTGGGTGTCCACTTGCGAAAGCAGCATTCCTATATTGAACAGGGCAAAAAATGTCGCTACTGTGATGCTGTGTTTCATGAGCGATATGCTCTCATCCAGCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Francisco Puerta Martínez et al.
Journal of virology, 88(13), 7389-7401 (2014-04-18)
Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA
Robert J Lake et al.
PLoS genetics, 10(3), e1004204-e1004204 (2014-03-08)
Mechanisms that maintain transcriptional memory through cell division are important to maintain cell identity, and sequence-specific transcription factors that remain associated with mitotic chromatin are emerging as key players in transcriptional memory propagation. Here, we show that the major transcriptional

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service