Skip to Content
Merck
All Photos(1)

Key Documents

EHU132531

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6V0A4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGATCCAAGAAGATGCCACTGAGAACATTGAAGGTGATAGCTCCAGCCCTTCTAGCCGTTCTGGCCAGAGGACTTCTGCAGATACCCACGGGGCTCTGGACGACCATGGAGAAGAGTTCAACTTTGGAGACGTCTTTGTCCACCAAGCCATCCACACCATCGAGTACTGCCTGGGCTGCATTTCAAACACAGCCTCCTACCTGCGGCTCTGGGCCCTCAGCCTGGCTCATGCACAACTGTCTGAAGTGCTCTGGACTATGGTGATGAACAGCGGCCTTCAGACGCGAGGCTGGGGAGGAATCGTCGGGGTTTTTATTATTTTTGCCGTATTTGCTGTCCTGACAGTAGCCATCCTTCTGATCATGGAGGGCCTCTCTGCTTTCCTGCACGCCCTGCGACTGCACTGGGTTGAGTTCCAGAACAAGTTCTATGTCGGGGATGGTTACAAGTTTTCTCCATTCTCCTTTAAACACATCCTGGATGGCACAGCCGAGGAGTAGGCTGAGGGCTGCACCTCCCACGGTGGTCACCATGCCAATGAAGGAAGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shulian Chen et al.
World journal of urology, 35(8), 1247-1254 (2016-12-26)
To investigate the effect of simulated physiological stretch on the expression of extracellular matrix (ECM) proteins and the role of integrin α4/αv, focal adhesion kinase (FAK), extracellular regulated protein kinases 1/2 (ERK1/2) in the stretch-induced ECM protein expression of human
ChangDong Lin et al.
Immunity, 50(1), 137-151 (2019-01-17)
Fever is an evolutionarily conserved response that confers survival benefits during infection. However, the underlying mechanism remains obscure. Here, we report that fever promoted T lymphocyte trafficking through heat shock protein 90 (Hsp90)-induced α4 integrin activation and signaling in T cells.
Yu Yan et al.
Aging, 11(9), 2699-2723 (2019-05-12)
Senescence is a leading cause of age-related cataract (ARC). The current study indicated that the senescence-associated protein, p53, total laminin (LM), LMα4, and transforming growth factor-beta1 (TGF-β1) in the cataractous anterior lens capsules (ALCs) increase with the grades of ARC.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service