Skip to Content
Merck
All Photos(1)

Key Documents

EHU077631

Sigma-Aldrich

MISSION® esiRNA

targeting human PCDH7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCCCACAGTTACCCTTCCCAAAAACATTTCCTACACTTTACTGCCACCTTCGAGTAATGTCAGGACAGTAGTAGCTACAGTGTTGGCAACAGACAGTGATGATGGCATCAATGCAGACCTGAACTACAGCATTGTGGGAGGAAATCCCTTCAAGCTGTTTGAAATTGATCCCACTAGTGGTGTGGTTTCCTTAGTGGGAAAACTCACCCAAAAGCATTATGGCTTGCACAGGTTGGTGGTGCAAGTGAATGACAGTGGGCAGCCTTCCCAGTCCACCACGACTCTGGTGCACGTGTTTGTCAATGAAAGTGTTTCTAATGCAACTGCGATTGACTCCCAGATAGCTAGAAGTTTGCACATCCCACTCACCCAGGATATAGCTGGTGACCCAAGCTATGAAATTAGCAAACAGAGACTCAGTATTGTCATTGGCGTGGTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaorong Zhou et al.
Molecular cancer research : MCR, 17(2), 594-603 (2018-11-10)
PROTOCADHERIN 7 (PCDH7), a transmembrane receptor and member of the Cadherin superfamily, is frequently overexpressed in lung adenocarcinoma and is associated with poor clinical outcome. Although PCDH7 was recently shown to promote transformation and facilitate brain metastasis in lung and
Ting Li et al.
Molecular therapy. Nucleic acids, 20, 545-557 (2020-04-25)
Long non-coding RNAs (lncRNAs) gradually show critical regulatory roles in many malignancies. However, the lncRNAs implicated in colon cancer recurrence are largely unknown. In this study, we searched the lncRNAs associated with metastasis and recurrence of colon cancer using GEO

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service