Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU195961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Srebf2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTCTGACCACAATGCCTGTGATGATGGGGCAAGAGAAAGTTCCTATCAAGCAAGTGCCTGGCGGCGTGAAGCAGCTGGATCCTCCCAAAGAAGGAGAGAGGCGGACAACACACAATATCATTGAAAAGCGCTACCGGTCCTCCATCAACGACAAAATCATAGAGTTGAAGGACTTAGTCATGGGGACAGATGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATATCTGCAGCAGGTCAATCACAAGCTGCGCCAGGAGAACATGGTGCTGAAGCTGGCCAATCAGAAAAACAAGCTCCTGAAGGGCATCGACCTGGGCAGTCTGGTGGACAGTGATGTGGACTTGAAAATTGATGACTTTAACCAGAATGTCCTTCTGATGTCTCCGCCGGCCTCCGACTCCGGGTCCCAGGCCGGCTTCTCTCCCTATTCCATTGACTCTGAGCCGGGCAGCCCTCTGCTGGATGACGCAAAGGTCAAGGATGAACC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Young-Chae Kim et al.
Genome biology, 16, 268-268 (2015-12-05)
Fibroblast growth factor-19 (FGF19) is an intestinal hormone that mediates postprandial metabolic responses in the liver. The unusual orphan nuclear receptor, small heterodimer partner (SHP), acts as a co-repressor for many transcriptional factors and has been implicated in diverse biological
Ji Miao et al.
Nature communications, 6, 6498-6498 (2015-04-08)
Despite the well-documented association between insulin resistance and cardiovascular disease, the key targets of insulin relevant to the development of cardiovascular disease are not known. Here, using non-biased profiling methods, we identify the enzyme flavin-containing monooxygenase 3 (Fmo3) to be
Kazuki Inoue et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 29(8), 1823-1832 (2014-03-29)
Clarification of the mechanisms underlying osteoclast differentiation enables us to understand the physiology of bone metabolism as well as the pathophysiology of bone diseases such as osteoporosis. Recently, it has been reported that epigenetics can determine cell fate and regulate
Kenji Fukui et al.
The Journal of biological chemistry, 290(44), 26383-26392 (2015-09-16)
Diabetes mellitus is associated with a variety of complications, including alterations in the central nervous system (CNS). We have recently shown that diabetes results in a reduction of cholesterol synthesis in the brain due to decreased insulin stimulation of SREBP2-mediated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico