Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EMU088231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Yap1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACACTGGAAGGAGATGCAATGAACATAGAAGGGGAGGAGCTGATGCCCAGTCTGCAGGAAGCGCTGAGTTCCGAAATCTTGGACGTGGAGTCTGTGTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTCACGTGGTTATAGAGCTGCAGGGAGCCACTCTGAGTCTGTGAGGGATCCACAGAGCCTAAGATGTGCACGCCTGAAATTCAGATAAGTCAGTGGGGGTTCTCTGGCTAACACAGAAAACAGATGAACCAGTGTCCATCGTTGTTCCGCTTTTCTCTGCCCGTCGCTGCTCTTACGTTGGTTGCTGACCTCTTCACGGCCGGCTCTAAAGAACCCGAACCGCAGACAGATTCCTTTGTTAACTCTGCTATGATAACTACGTTCTCTGGGATTGCTGGGGGATGGCCTGCTGGATAATGGATGTTCTGCCTTTTGTCCGGTGGTCCTTTCACCATCACTTTAACTGAACACACAGACTGGGAACTGAATGCTCTAGAACATTGTTCAAGAGGTGGTTTCTTCAGCTGC

Ensembl | mouse accession no.

ENSMUSG00000053110

NCBI accession no.

NM_009534

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... YAP1(22601) , Yap1(22601)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lise Lotte Christensen et al.
PloS one, 9(6), e96767-e96767 (2014-06-04)
MicroRNAs (miRNAs) play a critical role in many biological processes and are aberrantly expressed in human cancers. Particular miRNAs function either as tumor suppressors or oncogenes and appear to have diagnostic and prognostic significance. Although numerous miRNAs are dys-regulated in
Erica Lorenzetto et al.
Oncotarget, 5(9), 2608-2621 (2014-05-09)
The transcriptional coactivator YAP1 is a critical effector of the human Salvador-Warts-Hippo pathway. Literature data report apparently discrepant results on the carcinogenic role of YAP1, which acts either as oncogene or as tumor suppressor in different in vitro and in
Hyun-Jung Choi et al.
Nature communications, 6, 6943-6943 (2015-05-13)
Angiogenesis is regulated by the dynamic interaction between endothelial cells (ECs). Hippo-Yes-associated protein (YAP) signalling has emerged as a key pathway that controls organ size and tissue growth by mediating cell contact inhibition. However, the role of YAP in EC
David Fu et al.
Endocrine-related cancer, 21(2), 297-310 (2014-01-07)
The Hippo signaling pathway has been implicated as a conserved regulator of organ size in both Drosophila and mammals. Yes-associated protein (YAP), the central component of the Hippo signaling cascade, functions as an oncogene in several malignancies. Ovarian granulosa cell
C He et al.
Oncogene, 34(50), 6040-6054 (2015-03-24)
Mechanisms underlying ovarian cancer initiation and progression are unclear. Herein, we report that the Yes-associated protein (YAP), a major effector of the Hippo tumor suppressor pathway, interacts with ERBB signaling pathways to regulate the initiation and progression of ovarian cancer.
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico