Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU067171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xrcc6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCAAGCAAGCTGGAAGACCTGCTAAGGAAGGTTCGAGCCAAGGAGACCAAAAAGCGAGTTCTGTCCAGGTTAAAGTTTAAGCTCGGTGAAGACGTAGTACTCATGGTGGGCATTTATAACTTGGTCCAGAAAGCTAACAAGCCTTTTCCAGTGAGACTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACAAGGACTTTTAATGTAAACACCGGCAGTCTACTCCTGCCTAGTGACACCAAGCGGTCTCTGACTTACGGGACACGTCAGATTGTGCTGGAGAAAGAGGAGACAGAGGAGCTGAAGCGGTTTGATGAGCCAGGTTTGATCCTCATGGGCTTTAAGCCCACGGTGATGCTGAAGAAGCAGCACTACCTGAGGCCCTCTCTGTTCGTGTACCCAGAGGAGTCCCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Bahityar Rahmutulla et al.
Oncotarget, 5(9), 2404-2417 (2014-05-09)
The far-upstream element-binding protein-interacting repressor (FIR) is a c-myc transcriptional suppressor. FIR is alternatively spliced to lack the transcriptional repression domain within exon 2 (FIRΔexon2) in colorectal cancers. FIR and FIRΔexon2 form homo- or heterodimers that complex with SAP155. SAP155
Jin Meng et al.
Molecular medicine reports, 12(1), 581-586 (2015-02-20)
It was previously reported that the histone deacetylase inhibitor (HDACI) trichostatin A (TSA) induced B cell lymphoma 2 (Bcl-2)-associated X protein (Bax)-dependent apoptosis in colorectal cancer (CRC) cells. In addition, Ku70 has been identified as a regulator of apoptosis, the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico