Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU055151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTACTTCCCATCGCCTATGAGTTTAACCCAGAACTGGTGCTGATCTCAGCTGGCTTTGATGCTGCACAAGGGGATCCGCTGGGGGGCTGCCAAGTAACACCGGAAGGTTATGCCCACCTCACCCACCTACTGATGGGCCTTGCTGGTGGCCGTATTATTCTTATTCTAGAGGGTGGATACAATTTGGCATCTATCTCTGAGTCTATGGCTGCCTGCACCCATTCCCTCCTTGGAGACCCACCACCCCAGCTTACTTTGCTGCGACCGCCACAGTCAGGAGCCCTGGTTTCAATCAGTGAGGTCATCCAAGTCCATCGCAAATACTGGCGCAGTTTGCGGTTGAGTAAAATGGAAGACAAGGAAGAATGCTCTAGTTCTAGGCTTGTCGTCAAGAAGTTGCCCCCAACAGCCAGTCCTGTATCAGCTAAGGAAATGACCACACCGAAAGGAAAGGTTCCTGAAGAAAGCGTGAGGAAGACCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Smita Salian-Mehta et al.
The Journal of biological chemistry, 290(22), 14045-14056 (2015-04-16)
The impact of histone deacetylases (HDACs) in the control of gonadotropin releasing hormone (GnRH) neuronal development is unknown. We identified an increase in many HDACs in GT1-7 (differentiated) compared with NLT (undifferentiated) GnRH neuronal cell lines. Increased HDAC9 mRNA and
Regina Kanski et al.
Journal of cell science, 127(Pt 20), 4368-4380 (2014-08-17)
Glial fibrillary acidic protein (GFAP) is the main intermediate filament in astrocytes and is regulated by epigenetic mechanisms during development. We demonstrate that histone acetylation also controls GFAP expression in mature astrocytes. Inhibition of histone deacetylases (HDACs) with trichostatin A
Yixuan Li et al.
Molecular and cellular biology, 35(20), 3547-3565 (2015-08-05)
Histone deacetylase (HDAC) inhibition leads to cell cycle arrest in G1 and G2, suggesting HDACs as therapeutic targets for cancer and diseases linked to abnormal cell growth and proliferation. Many HDACs are transcriptional repressors. Some may alter cell cycle progression
María-Soledad Valera et al.
Retrovirology, 12, 53-53 (2015-06-25)
Human immunodeficiency virus type 1 (HIV-1) has evolved a complex strategy to overcome the immune barriers it encounters throughout an organism thanks to its viral infectivity factor (Vif), a key protein for HIV-1 infectivity and in vivo pathogenesis. Vif interacts

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico