Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU044471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd19

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTCCCAGTCCTATGAAGATATGAGAGGGATCCTCTATGCAGCTCCTCAGCTCCACTCAATTCAGTCCGGTCCCAGTCATGAAGAAGATGCAGACTCTTATGAAAACATGGATAAGTCTGACGACCTAGAACCAGCATGGGAAGGAGAGGGCCACATGGGGACTTGGGGAACCACGTGACTCCCAAGTGACTAGCCTGGACTTCGTTAGGTCCCAAGAACCACATCTGATTCTGAAATCTGGAGATCCCAGATGGTGTCAGTCAGTGAAATGACCTTGATCAGGATGTGTGCTAGCTGACACACACACACTCATATGCATGTTCAAGCAAAGCTTCCTTTTGACCCTTTGCTTTCCCCAAATAAACCCAATTAGCCACTCAAATTCTCTGAAGCCGGCCCTTGTGTGGGATAGGAAGATGGGGTTGAATCCAGCCCTGAGTCACCCAGAGGAAGGAGAACTGAGGTCTGAGTACATCCTGGCTCTAGCCTTCCCATGGCCTGGCATTTAGCCACCTAACATCCAGTGATGCAAATATGTCCAGCCGCTACATTCCATGGTGTCCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mauricio Menacho-Márquez et al.
PLoS biology, 11(7), e1001615-e1001615 (2013-08-13)
The catalytic activity of GDP/GTP exchange factors (GEFs) is considered critical to maintain the typically high activity of Rho GTPases found in cancer cells. However, the large number of them has made it difficult to pinpoint those playing proactive, nonredundant
Areumnuri Kim et al.
Oncotarget, 6(35), 38225-38238 (2015-10-31)
Although proteasome inhibition with bortezomib (BTZ) is a validated treatment for relapsed or refractory mantle cell lymphoma (MCL), many patients show resistance to BTZ. However, the molecular mechanism of BTZ resistance in MCL has not been elucidated. In the present
Tai Kiuchi et al.
Science signaling, 7(339), ra78-ra78 (2014-08-21)
The epidermal growth factor receptor (EGFR) is a member of the ErbB family that can promote the migration and proliferation of breast cancer cells. Therapies that target EGFR can promote the dimerization of EGFR with other ErbB receptors, which is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico