Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU043441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hspa2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAGACGCAGACCTTCACTACCTACTCAGACAACCAGAGCAGCGTGCTGGTGCAAGTGTACGAGGGCGAACGGGCCATGACCAAGGACAATAACCTCTTGGGCAAGTTCGACCTGACTGGGATCCCCCCAGCACCCCGTGGGGTCCCCCAGATCGAGGTCACCTTTGACATCGATGCCAACGGCATCCTTAACGTCACTGCTGCCGACAAGAGCACCGGTAAAGAAAATAAAATCACCATAACCAACGACAAGGGTCGGCTGAGCAAAGACGACATTGACCGGATGGTGCAGGAGGCGGAGCGGTACAAATCGGAAGATGAAGCAAATCGCGATCGCGTGGCAGCCAAAAATGCGGTGGAGTCCTATACCTACAACATCAAGCAGACCGTGGAAGACGAGAAACTGAGGGGCAAGATTAGCGAGCAGGACAAAAACAAGATCCTCGACAAGTGTCAGGAGGTGATCAACTGGCTTGACCGAAACCAGATGGCAGAGAAAGATGAGTACGAACACAAGCAGAAAGAGCTTGAGAGAGTGTGCAACCCCAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dmitry Kondrikov et al.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Kanika Jain et al.
Cell stress & chaperones, 19(6), 801-812 (2014-03-05)
The fall in ambient oxygen pressure in high-altitude milieu elicits a wide range of physiological responses in the myocardium, which may differ from individual to individual. This condition, known as hypobaric hypoxia, invokes the cardioprotective heat shock response. The present
Sujatha Muralidharan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico