Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU042191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wee1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGACATGGAAGCCAGTGATTATGAGTTTGAAGATGAAACAAGACCTGCCAAAAGAATTACAATTACTGAAAGCAACATGAAGTCACGGTATACAACTGAATTTCATGAGCTGGAGAAAATTGGTTCTGGAGAATTTGGTTCTGTGTTTAAATGTGTGAAGAGGTTAGATGGATGCATTTATGCCATTAAACGATCAAAAAAACCATTGGCTGGCTCTGTTGATGAGCAGAATGCTTTGAGAGAAGTGTATGCTCACGCTGTGCTTGGACAGCACCCCCACGTCGTTCGCTATTTCTCTGCCTGGGCAGAGGATGACCACATGCTTATACAGAACGAATACTGTAATGGTGGGAGTTTAGCTGATGCTATAAGTGAGAACTACAGAGTCATGAGCTACTTGACTGAAGTAGAGCTGAAGGATCTCCTTTTGCAAGTTGGCCGGGGCTTGAGATACATACATTCAATGTCTTTGGTTCACATGGATATAAAACCTAGTAATATTTTTATATCTCGAACCTCAATCCCAAATGCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ana Slipicevic et al.
Gynecologic oncology, 135(1), 118-124 (2014-08-06)
Wee1-like kinase (Wee1) is a tyrosine kinase which negatively regulates entry into mitosis at the G2 to M-phase transition and has a role in inhibition of unscheduled DNA replication in S-phase. The present study investigated the clinical role of Wee1
Koji Hatano et al.
Nucleic acids research, 43(8), 4075-4086 (2015-04-08)
MicroRNAs (miRNAs) have been implicated in DNA repair pathways through transcriptional responses to DNA damaging agents or through predicted miRNA regulation of DNA repair genes. We hypothesized that additional DNA damage regulating miRNAs could be identified by screening a library
Gry Irene Magnussen et al.
BMC cancer, 15, 462-462 (2015-06-10)
Malignant melanoma has an increasing incidence rate and the metastatic disease is notoriously resistant to standard chemotherapy. Loss of cell cycle checkpoints is frequently found in many cancer types and makes the cells reliant on compensatory mechanisms to control progression.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico